Death march kara hajimaru isekai kyusoukyoku Capitulo 14-5

Reino Yowok (2)
Satou está aquí. Encontrar parientes
durante la ida a casa después de un largo tiempo es divertido.
Sin embargo, de acuerdo a mi amiga de la
infancia, fue el tiempo de penitencia para asuntos de boda, ella murmuro.
[Kiel: Satou está hablando de
Mito/Hikaru…]


Investigo la información detallada del
señor demonio que encontré en el [Laberinto Goblin] bajo el castillo real del
Reino Kubooku en el Reino Yowok.
Excepto por el título [Señor Demonio],
el señor demonio tiene algunos otros títulos, tales como [Adicto a las
Apuestas], [Rey en Deuda], [Padre Bueno-para-Nada].
Su raza es [Pariente Gran Oni (Ogro)],
nivel 55 y solo una Habilidad Única [Todo-o-Nada].
Escuche que los que tienen solo una
Habilidad Única raramente se tornan en un señor demonio, así que el
probablemente tenía dos inicialmente, una fue dada al chico Shin, [Maestro
Hechicero].
Liza sola tal vez sea capaz de
derrotarle justo ahora.
De paso, no veo algún gran demonio y hay
solo un demonio medio en espera cerca al señor demonio.
Hay demonios menores situados en los
cuartos que manejan el laberinto localizados en el piso 10 a 30, con cada
habitación teniendo un demonio. Es como un juego de calabozos de las obras
maestras de hace años.
[Kiel: Se refiere al Juego Calabozos y
Dragones, donde las habitaciones principales/importantes tienen ‘jefes’.]
Este laberinto es mayormente ocupado por
demi-goblins y monstruos tipo rata, hay también demi-ogros, primera vez que veo
ese tipo, arrastrándose en los pisos profundos.
Mirando a esto desde el punto de vista
explorador, este es un laberinto extremadamente improductivo. Puedes solo
conseguir dinero desde los núcleos mágicos y ocultarte de los monstruos tipo
rata.
Quizás debido a eso los aventureros en este
laberinto generalmente tienen bajos niveles.
La mayoría son menores de 30, y el único
más alto está en el equipo que ha ido más profundo al piso 48.
Parece que los otros equipos excepto ese
están solo a la par con los enemigos a nivel 20 en el piso 29. La razón es
probablemente el jefe medio Demi Ogro nivel 40 en el piso 30.
“¡Esta ahí!”
“¿En verdad vas a matarlo?”
“¡Por supuesto! ¿Él casi nos mata sabes
ya?”
Escucho voces familiares de chicos y
chica desde atrás.
Aparentemente, ellos me siguieron en
venganza tras de mí.
Probablemente el efecto de la habilidad
de la chica [Persecución]
Ellos podrían solo volverse guardias.
Un monstruo sonando fuerte, el Demi
Goblin Berseker, se acerca desde el frente, pero es solo un monstruo y su nivel
no es diferente a sus niveles.
Ellos deberían ser capaces de hacer algo
sobre esto si en verdad son aventureros.
Me teletransporto al piso 48 donde el
equipo más alejado esta antes de que ambos lados puedan alcanzarme.
Quiero recomendarles a ellos evacuar ya
que hay una posibilidad que sean tragados en mi batalla con el señor demonio.
El líder de equipo es un guerrero mágico
nivel 53 con el título [Sirviente del Héroe].
No sabía que tal mujer mayor estuviera
entre los compañeros de Hayato que son todas jóvenes bellezas.
Sus compañeros son solo nivel 36,
caballero sagrado, seis caballeros pesados, dos magos, dos sacerdotes, un
explorador y cuatro carga equipajes. Dejando fuera los carga equipajes, el
nivel promedio es 31, bastante alto.
Parece que los rangos altos son niveles
razonablemente altos aunque es un laberinto de un pequeño reino.
Ellos serán sorprendidos si
repentinamente me teletransporto en frente de ellos, así que voy a la
habitación dos cuartos lejos de ellos.
La razón de porque no voy a la
habitación adyacente es porque el esclavo carga equipajes está ahí.
“¡¿Monstruo?!”
“¡¿Acaso rompieron a través de la
barrera anti-monstruos del amo?!”
Al momento que piso la habitación donde
los esclavos están, soy atacado con pequeñas bolas de fuego como pensando que
soy un monstruo.
Parece que ellos tienen varas de fuego
para auto-defensa.
Ignoro las bolas de fuego, me muevo ante
los esclavos con Encoger Suelo, y tomo los peligrosos juguetes de ellos.
“Calma. Soy un humano.”
Escuchándome, los esclavos prontamente
saltan atrás y toman las lanzas cortas apiladas en las montañas de equipaje.
Ya que sus niveles son 20 y ellos tienen
habilidad de lanza y magia de vida, son probablemente razonablemente confiables
en su habilidad.
Puedo vencerlos primero antes de hablar
con ellos, pero me sentiría culpable como tomando sus berrinches en el
laberinto.
“Muéstranos tu medalla.”
“Aquí.”
Siguiendo su demanda y les arrojo a
ellos la medalla aventurero que justo hice.
“¡¿Rango F?!”
“¡Tsk, una medalla de aventurero falsa
huh!”
Parece que se volvieron innecesariamente
más cautelosos aunque seguí su demanda.
–¿Oh?
El punto luminoso de un caballero pesado
en la siguiente habitación ha desaparecido.
Había solo un Lord Demi Ogro y dos Demi
Ogro Guardia en la sala donde antes pero ahora hay 30 Demi Ogros Ejecutores que
aparecieron antes de saberlo.
Probablemente el señor demonio está
haciéndolo como [Maestro de Calabozo], pero es demasiado enojado para
asesinarlos.
“Lo siento, pero no hay tiempo para
jugar aquí.”
Mientras digo eso a los esclavos, los
neutralizo con la magia de supresión inter-personal, [Presión de Sonido].
Instantáneamente me muevo a la puerta
cerrada que conecta a la siguiente habitación, y forzadamente la pateo.
Fue un poco brusco, pero usar magia de abertura
mágica sería demasiado lento, así que no se puede evitar.
“¡Zana, retírate mientras cubres las
espalda de Jeff!”
“¡Entendido!”
“¡Blum-baasan también, rápido!”
“¡Quien es baasan!”
[TLN: Baasan significa mujer anciana.]
Ellos aún luchan duro incluso mientras
son rodeados por demi ogros de tres metros de alto empuñando hachas negro
azabache. Desafortunadamente, otro de los puntos luminosos desaparece.
La mujer mayor guerrera mágica llamada
Blum apunta al tendón de las piernas de los Demi Ogros para ralentizar su
persecución usando un espadón con hoja azul.
Pensé que fue una espada sagrada por un
instante, pero ya que está emitiendo luz roja, es probablemente un tipo de
espada mágica.
“Torin y Silje, peleen conmigo contra
estos monos con hacha.”
“Es en serio.”
“Conseguí la parte más corta de la
pajita.”
“¡Les daré una bolsa de monedas de oro
por cada ogro que derroten, quedo claro!”
Ahora bien, lo siento por ellos que han
sido animados, pero limpiare esto rápido.
Marco las posiciones de los demi ogros
en el mapa.
Invoco la magia intermedia de tierra
[Arrojar Hierro].
Conos de hierro del tamaño de postes
telefónicos aparecen desde debajo de los demi ogros, acribillándolos uno tras
de otro.
Gritos de caballos de los demi ogros
hacen eco en la sala, pero no parece como conseguí algún tipo de habilidad de
lenguaje.
“¡¿Qu, magia?!”
Mirando a los demi ogros que elevan
nubes de polvo y conos de hierro más allá del polvo, Ms. Blum voltea a mirar
detrás mientras da voz a su sorpresa.
Aunque no detiene sus pies moviéndose
hacia aquí, probablemente para alejarse lejos de la masacre.
Los gritos desaparecieron antes de
saberlo, veo cuerpos pinchados detrás de la nube de polvo.
…Asqueroso.
No es una escena en verdad que quiera
ver, así que extiendo mi [Mano Mágica] para recolectar sus cuerpos junto con
los conos de hierro dentro del Almacén.
Dejo los cuerpos de los demi ogros
guardia que fueron derrotados y demi ogro lord que debería haber sido derrotado
solo.
“¿Acaso tú los derrotaste?”
“Eso es correcto. Tal vez sea una medida
innecesaria, pero tengo algunos asuntos aquí ya vez.”
“No, en verdad nos salvaste.”
Ms. Blum Julberg habla como un hombre,
pero ella es una belleza.
Ella tiene más de 88 años, hubiera amado
conocerla hace 60 años.
De acuerdo a la info del mapa, parece
que es la madre de Zeff Julberg, el jefe de las Ocho Espadas Shiga.
“¿No eres el nuevo apóstol o el nuevo
héroe del Imperio Saga?”
“No. Tengo una pregunta también, ¿no
eres una sirviente del Héroe Hayato?”
“¿Hahn? Yo, ¿sirviente de ese patán
Hayato? Que broma.”
Aparentemente supuse mal.
“Soy una sirviente del héroe anterior.”
Por anterior, eso significa que el que
peleo contra el señor demonio hace 66 años.
Aún está en su deber cuando ella esta
cercas de sus 90, eso es asombroso.
“Hou, uno de los héroes que extermino al
señor demonio huh–¿son los otros aun activos también?”
“No hay manera. Las que aún quedan vivas
son la santidad Riri y la elfo Sea. Riri ha envejecido y raramente ella sale
del santuario sagrado. Sea está bien pero ella esta retirada ahora y debería
estar trabajando para conseguir ingresos. A esa chica nunca le gusto pelear
después de todo.”
¿Por Sea me pregunto si es Sebelkea de
la ciudad laberinto?
La miko de cabecera del templo Tenion
dijo que ella era un sirviente del héroe anterior, así que la santidad Riri tal
vez sea ella. Ella probablemente consiguió el nombre [Yu Tenion] cuando se
volvió la miko de cabecera.
Cuando estaba considerando tal cosa, una
de sus compañeras reservadamente le llama.
“Blum-baasan, Kiru y Gotz no pudieron
hacerlo.”
“Ya veo… Aquellos dos eran excelentes
usuarios de escudo.”
El joven explorador hombre que revisa a
sus compañeros muertos reporta con un rostro deprimido.
“No hay manera que podamos retar al『Maestro de Calabozo』sin algún usuario de
escudo.”
“Cierto, incluso si Blum-baasan es
fuerte–”
Los dos usuarios de lanzas hacen
remarques tímidos, pero pensé que sus niveles no eran suficientes para retar al
[Maestro de Calabozo] incluso si fuera el equipo completo.
Antes de todo, el oponente no es un
común [Maestro de Calabozo] sino un señor demonio a pesar.
“Zana, usa el rollo『Teletransporte』y toma a todos de
regreso.”
Después de contemplar, Ms. Blum ordena a
unos de los caballeros.
Parece que se preparan para escapar del
laberinto.
“¿Qué es lo que  Blum-baasn va a hacer?”
“Iré a ver al『Maestro de Calabozo』con este nii-san de
cabello blanco”
“No seas absurda, Blum-baasan. No puede
ganar con dos personas no importa que tan poderoso sea esa persona como mago.”
De alguna forma ellos continúan la
conversación sin mí.
“Espera, no tengo la intención de
llevarte conmigo.”
“¿Soy útil sabes? Mi esgrima es tan
bueno como las Ocho Espadas Shiga, y mi magia de rayo no perderá ante el viejo del
Rayo del Condado Seryuu. De paso, puedo incluso usar magia sagrada a nivel
intermedio.”
¿Acaso un nivel 50 tiene tantas
habilidades?
…Tal vez sea posible con bendición de
orbes o regalos.
“Eso es asombroso, pero eres solo una
carga.”
“¿Quieres ver mi habilidad?”
Ella es rápida para actuar.
“¿Por qué quieres ver al『Maestro de Calabozo』tanto?”
“Por el bien de cernir si este maestro
de calabozo es un señor demonio o no–”
“¿Qué es lo que harás una vez estés
segura?”
“No es eso obvio. Enviare esa
información al Héroe de la actual generación.”
Ya veo, ella no es alguien suicida que
quiere buscar su lugar para morir por pelear con el señor demonio.
Mirando a su nivel, debería ser una
batalla bastante cerrada, pero ya que el señor demonio usa técnicas
irrazonablemente tramposas, no puedes pelear con ellos a menos que tengas
ciertas medidas.
Sin embargo, ella llego hasta aquí,
justo antes del sitio de pelea después de todo, ella tiene la cualificación
para al menos ver al señor demonio.
“Muy bien. Te tomare solo a tí.”
“Gracias. Soy Blum Julberg. Te
agradeceré plenamente una vez regresemos a tierra.”
Una vez fue zanjado, sus compañeros se
teletransportaron uno tras de otro, dejando la mayoría de su equipaje.
Debido al límite del rollo, ellos no
pueden transportarse al suelo, sino al área segura en el piso 29.
“Ahora bien, vamos–¿qué estás
haciendo?”
“Esto es un espantapájaros para explorar
un poco.”
Blum-baasan que regreso luego de tomar
algo de equipaje fuera de la sala inclina su cabeza en confusión mirando una
armadura a cuerpo completo en frente de mí.
Esta armadura es algo con lo que mate
tiempo cuando estaba haciendo los golems de bronce.
Use esto con magia [Crear Golem] para
convertirlo en un golem.
De paso, puse una máscara disfraz y una
espada sagrada casteada en esto, completo.
Estoy pensando en teletransportar esto
al Cuarto del Maestro de Calabozo donde el señor demonio esta con la magia de
espacio [Transportar un Objeto] para revisar la habilidad única del señor
demonio.
Tal vez sea demasiado cauteloso contra
un señor demonio nivel 50, pero el nombre de su habilidad única [Todo-o-Nada]
suena peligrosa, así que es solo un seguro.
“■■■■■■■ …. ■■ Transportar un Objeto”
Una vez mi largo canto es terminado, el
golem explorador desaparece desde la habitación.
Luego, uso [Clarividencia] y [Oído
Claro] sin canto comparto la visión y oído del golem.
Ahí veo–.
“Uwaaaaaaa. ¡A-alejate! ¡Tú maldito
héroe! Y-yo–¡AAAAAAAAH!”
Puedo escuchar al señor demonio que
suena como que se volvió loco a través de la magia.
Veo un ogro estilo japonés (oni) con
cabello corporal color violeta encogido lejos como si estuviera asustado del
espantapájaros de cobre. Los ojos del señor demonio están fijados en la espada
sagrada casteada.
El cuerpo del señor demonio está
envuelto en luz violeta–.
Después, luz cubre mi vista a través de
Clarividencia, y una explosión como granada puede ser escuchada a través de
Oído claro.
“¿Q-qué? Este sonido y vibración–parece
que en verdad hay un señor demonio ahí.”
Ms. Blum muestra una sonrisa sin miedo y
entonces comienza a poner magia de soporte en si misma y yo.
Sin embargo, eso fue una acción sin
sentido.
Miro a la sentencia que apareció en mi
registro.
>Titulo [Asesino del Señor Demonio『Rey Gran Oni』] Adquirido.
Aparentemente el señor demonio se voló a
sí mismo.
Ya que pude ver la luz violeta a través
de Clarividencia, apuradamente salte al Cuarto del Maestro de Calabozo con
[Teletransporte.]
『Ese viejo pedorro
tonto y se voló a sí mismo. Ya no puedo ganar si ya es capaz』
Corto el [Fragmento de Dios], que está
volando lejos hacia el techo mientras refunfuña, con la Espada Divina.
Después de confirmar que la luz violeta
ha sido absorbida en la Espada Divina, pongo la espada de vuelta al Almacén.
El demonio medio que estaba en esta
habitación ha sido asesinado en la explosión del señor demonio, un núcleo
mágico rojo oscuro esta tirado en la esquina del cuarto.
Dos enormes esferas están tiradas en una
parte de la habitación.
De acuerdo al lector AR, son el [Núcleo
Falso] y un [Núcleo de Caos].
Ya que el Núcleo Falso está chispeando
como si fuera a explotar y el Núcleo Caos comenzó a escupir niebla negra que
parece maldito, rápidamente los almaceno.
Si no estoy equivocado de acuerdo a Arisa
un [Núcleo de Calabozo] debería estar en el cuarto del [Maestro de Calabozo],
pero no parece estar aquí.
De acuerdo al mapa, hay un [Rey Momia] y
varias [Momias].
Aunque es un Rey Momia, no parece estar
relacionado con Cadáver que está viviendo en la capa inferior del laberinto de
Selbira.
…La familia de Arisa huh.
¡UOWOONUWOOOORWEYEEEEE!
[TLN: Escrito en latín en el original,
suena como “maldito” en japonés.]
Las momias se acercan mientras dejan
salir voces de resentimiento.
Desafortunadamente, la conversación no
parece ser posible aunque es un Rey Momia como Cadáver.
Pensé en cremarlos con magia de fuego
[Tormenta de Fuego], pero debería preguntar a Sera a purificarlos con magia
avanzada.
Después de reportar a Ms. Blum y tomarla
a la Habitación del Maestro de Calabozo a través de la ruta normal, ella cree
en mí solo con eso.
Ella estaba sorprendida al verme usar
magia sin canto, pero ella está convencida que soy una persona reencarnada por
su propio sentido.
La envió de regreso a sus compañeros ahora
que ella ha completado su objetivo, y entonces voy de regreso para encargarme
de los asuntos.
Ahora que he derrotado al señor demonio
que era el [Maestro de Calabozo], parece que me volvi el gobernante de este
laberinto, y puedo moverme aquí con Mover Unidad.
Tomando ventaja de esto, elimino los
demonios menores restantes y recolecto los documentos escritos en [Lenguaje
Demonio] que están en sus habitaciones.
Usando Mover Unidad, me muevo al
laberinto Selbira donde Sera y las otras están.

“¡Satou-san!”
Sera que me nota agraciadamente viene
hacia mí.
La princesa y Lady Karina están sentadas
en simples sillas estando exhaustas por la intoxicación de subir nivel,
mientras Zena-san está mirando a ellas.
“Amo, hemos completado la cuota de esta
sala.”
“Master, espero por suministro a través
de circulación de poder mágico.”
Liza que quema las cucarachas escondidas
con cañón de filo mágico y Nana que las destroza con la pistola de aceleración
tipo escopeta regresan.
“Gracias por su arduo trabajo. Vamos a tener
un almuerzo.”
Después de decir eso, tomo a todas al
palacio en la isla solitaria.
Cancelando la permanente puerta de
teletransporte.
Sin decirles lo que paso en la mañana,
todos disfrutamos un delicioso almuerzo.
“Arisa, Lulu, y también Sera-san, puedo
tener un poco de su tiempo.”
“Eso es bastante del Amo.”
Muestro la medalla aventurero a Arisa
que mira curiosa.
“¡E-esta es una medalla aventurero!
¡Quiero una! Hey, hey, donde–”
Su expresión se congela cuando ella ve
la marca de rama [Gremio de Aventureros Buro del Laberinto del Reino Yowok]
detrás de la medalla.
“Así que fuiste ahí. A ese laberinto…”
“Si, y tengo algo que hablar sobre
eso–”
Le digo sobre las momias.
“Así que me gustaría pedir a Sera-san a
purificarlos.”
“Si, por favor déjamelo a mí.”
Sera que supone el humor a propósito
dice eso en tono brillante.
“Arisa y Lulu, ¿Qué es lo que quieren
hacer? Las tomare conmigo si quieren verlos a ellos, pero si es duro para
ustedes, pueden visitar las tumbas una vez todo esté terminado.”
“Un, voy a ir. Es el deber de los vivos
darle el adiós a los muertos.”
“Voy a ir también. Había solo hablado
con el rey pocas veces, pero él es aún el padre de Arisa y mio.”
Arisa claramente da su deseo a ir con
nosotros después de limpiar sus lágrimas con su brazo.
Lulu que reconforta a Arisa asiente
mientras la apoya.
“Entonces, vámonos.”
Tomo a las tres al subsuelo del
laberinto con Mover Unidad.
“Hey, Sera-san.                ¿Puedes por favor recitar el hechizo『Requiem』una vez?
“¿Por qué? Tengo que usar un montón de
poder mágico para『Requiem』, así que no sere capaz de usarlo hasta mañana si lo uso incluso una
vez ¿sabes?”
Sera frunce el ceño a la repentina
pregunta de Arisa.
“Te lo pido también.”
“No puedo rechazar si es una solicitud
de Satou-san.”
De alguna forma entiendo lo que Arisa
quiere hacer, así que se lo pido también.
Incluso si no entendía el deseo de
Arisa, puedo solo suministrar el poder mágico y pedírselo a Sera una vez más.
Sera termina un largo hechizo como
réquiem.
“–Un, lo he memorizado.”
Arisa tenuemente murmura.
“Entonces, vamos.”
Sostengo los hombros de Arisa y vamos a
la habitación donde las momias están esperando.
“Ha sido un tiempo Padre. No es como
siempre te llame así. Sin embargo, quiero llamarte ‘padre’, no ‘su majestad’,
al final. Onii-chans también perdónenme por la tardanza.”
Retengo a las momias con magia de fuerza
avanzada [Brazo Mágico].
Dreno poder mágico de las momias que van
a usar magia algunas veces, y destruyo los ataques mágicos que han exitosamente
invocado con Romper Magia.
“Está bien hoy ¿cierto?”
“Si.”
Después de terminar su despedida, Arisa
mira a mí para revisar.
Cuando consiento, Arisa murmura
“Gracias”.
Dos destellos de luz violeta corren por
el cuerpo de Arisa.
Probablemente las Habilidades Únicas
[Nunca Rendirse] y [Over Boost].
También elijo algunas magias de apoyo
como [Aumentar Magia] y [Subir Calidad de Magia] desde mi Columna de Magia, y
los uso en Arisa.
“…■■ Requiem”
El cuarto es envuelto en luz azul una
vez Arisa termina el largo hechizo.
Las momias dejan de moverse y comienzan
a caer en pedazos, volviéndose arena dorada.
De alguna forma veo sonrisas en los
rostros de las momias.
“–Arisa”
“Ah, padre, madre… Onii-chans también…”
Figuras del rey, la rey y los príncipes
que asemejan a Arisa pueden ser vistos sobre las derrumbadas arenas doradas.
Un príncipe de aspecto amable y uno de
aspecto chispeante sacuden sus manos hacia Arisa y entonces desaparecen.
No puedo escucharlos, pero entiendo que
ellos están diciendo que aman a Arisa.
El rey acaricia la cabeza de Arisa con
su mano transparente, y entonces extiende esa mano hacia Lulu.
“–¿Su Majestad?”
El alma del rey muestra una expresión
ligeramente solitaria escuchando a Lulu, pero gentilmente acaricia la cabeza de
Lulu.
“Lulu, di Padre.”
“S-sí. Padre… Se siente extraño de
alguna manera. Padre, yo y Arisa estamos viviendo felizmente así que–”
“¡Eso es correcto! ¡Estamos acarameladas
con nuestra persona amada todo el día, así que esperen en el cielo en paz!”
Uniendose a Lulu, Arisa pone su ánimo
sin incluso limpiar sus lágrimas fluyendo.
Los cuerpos de las dos personas se
vuelven más transparentes mientras parecen aliviadas.
Antes de que desaparezcan, el rey hace
un gesto hacia mi hombro.
Como su actual guardián, asiento al rey,
y entonces el rey y la reina desaparecen mientras parecen contentos.
“¿Me pregunto si ellos descansan en
paz?”
“Um, seguro que están en paz. Mama
también esta esperando allá, así que ellos tal vez estén bien.”
Lulu asiente a las palabras de Arisa.
Ahora que pienso en esto, ellas me
dijeron que la madre de Lulu, Lili murió protegiéndolas cuando el castillo fue
atacado.
Arisa quería detenerse, así que nos
transportamos al cementerio público donde la mama de Lulu está descansando con
[Mover Unidad] viendo a través de la retirada.
Después de rezar y ofrecer un ramo de
flores en el cementerio publico donde la mama de Lulu descansa, nos movemos una
vez a la torre sin ventana arruinada del castillo Kubooku.
Aparentemente, Arisa estaba viviendo en
esa torre durante su aprisionamiento.
“Entonces iré a la torre, puedes pasear
por el pueblo. Contactare contigo con『Teléfono』una vez termine.”
“¿Debería ayudarte con llevarte?”
“No puedes. La torre está llena de un
secreto de doncella.”
Arisa desaparece dentro de la torre con
una sonrisa fugaz.
Su destino de teletransporte
probablemente es la ventana.
Estoy interesado en que dejara en la
torre cuando baje como eso, pero ya que ella no quiere mostrarme, dejare que
ella haga lo que quiera.
“Ahora bien, ¿Por qué no tomamos un
paseo alrededor del pueblo mientras esperamos por Arisa?”
“Si, permítame guiarlo.”
Lulu comienza a caminar mientras guía mi
mano.
Sera que agarra mi otra mano me pregunta
con voz baja.
“Satou-san, ¿está bien para nosotros que
deberían estarse moviendo en el barco mostrarse en frente de la gente?”
“No te preocupes sobre eso.”
Casualmente respondo y paso velo de
inhibición de reconocimiento a Lulu y Sera.
Estoy vistiendo una bandana de
inhibición de reconocimiento como Satou. Sera no le gustaría y conmigo cuando
soy Kuro.
“Amo, este es el soba horneado.”
“Se ve bastante galante no es así.”
Es un platillo donde la harina de soba
es horneada y entonces añadida con pepinillos finamente picados.
No creo que sea sabrosa, pero ya que
Lulu está comiendo mientras parece nostálgica, vamos a no meter los pequeños
detalles.
No parece ser adecuado para el paladar
de Sera, su rostro parece complicado, así que le doy las sobras a una pequeña
niña que nos mira con envidia.
Cuando miro de cercas, hay un montón de
niños sucios ahí.
Ahora que lo pienso, esta es la capital
de una nación derrotada huh.
Pregunto a Lulu que nos guie al templo
cercano.
“¡Como he dicho! ¡Donaremos el pago
luego!”
“No pueden. Todos los aventureros son
gente que evaden el pago, así que no los sanare sin un pago adelantado.”
La chica de engaño de antes que me
persiguió al laberinto esta disputando con una sacerdotisa en frente del
templo.
Los chicos sangrando que están con ella
parecen como no tener el poder de voluntad para participar en la disputa, ellos
solo están limpiamente en el suelo.
Mirando en el lector AR, su vida no
parece estar en peligro.
“… Kuku, Jido, Bado.”
Lulu murmura al lado mío.
Pensé que ella le conocía y fue sorpresa
cuando veo la información detallada de la chica. Parece que ella es la hermana
menor de uno de los primos de Lulu.
Ya que el rostro de Lulu parece pálido
tras el velo, juzgo que no tienen una buena relación, así que paso a través de
ellos y voy a la recepcionista para donar.
“¡Oh mi, darnos esto tanto de donación!”
La sacerdotisa cuyas mejillas se pierden
en sonrisa agarra mi mano y llora lágrimas de alegría.
Me siento avergonzado viendo que ela
este feliz recibiendo varias monedas de oro. Estoy planeando donar a los otros
templos y orfanatos, así que solo daré un poco a cada lugar.
“¡O gente piadosa, que dios les bendiga!
■■■ Bendición”
La sacerdotisa me da bendición a mí y
Lulu mientras limpia sus lágrimas.
Sera no vino con nosotros debido a la
razón de religión.
> [Magia Sagrada: Creyente Garleon]
Habilidad Adquirida.
Conseguí una nueva habilidad gracias a
la bendición de la sacerdotisa.
No tengo planes para usarlo, así la
asignación de puntos es para luego.
“¡Espera! ¡El tipo rico de por ahí!
¡Danos algo a nosotros también!”
Cuando salimos fuera del templo, la
chica llamada Kuku que estaba disputando con la sacerdotisa en la entrada
agarra el hombro de Lulu. Su dedo atrapa el velo de Lulu, removiéndolo.
“–Ah”
“¿Eh? ¿Lulu?”
Las dos se miran una a la otra.
Sin embargo, eso no lleva a la
conversación.
Boom, Kuku fue arrojada al suelo.
Lulu cuyo hombro fue atrapado arrojo a
Kuku lejos con el apoyo de su habilidad [Auto-Defensa].
Recupero el velo de Lulu de la chica
desmayada y lo pongo en Lulu.
“¡U-um! ¿Alguna herida? ¿Están heridos
en algún lado?”
“No, esta chica es una excelsa artista
marcial ya ve.”
La sacerdotisa desde el escritorio de
donación corre fuera y pregunta si estamos heridos.
Ella no toma alguna nota de la desmayada
Kuku y los chicos desmayados debajo.
Me despido con una sonrisa y paso la
ciudad mientras dono.
Junto al camino, escuchamos un
estruendoso rugido desde la dirección del castillo, pero puedo de alguna forma
suponer la razón, así que continuo sin meditarlo.
『Gracias por esperar~ He hecho la limpieza.』
“El rugido de antes fue en verdad Arisa
¿huh?”
『Ehehe~ Limpiar mi historia oscura era demasiado trabajo, así que borre
todo junto con la torre con [Desintegrar]』
“Ni uno fue herido ¿correcto?”
『Pero por supuesto.
Arisa-chan nunca hace una equivocación.』
Después de recibir el reporte de Arisa,
continuamos el paseo con cuatro personas y entonces vamos de regreso a la isla
solitaria.
“Hogar dulce hogar.”
“Oh Arisa. Solo nos quedamos aquí una
vez.”
Lulu retuerce las palabras cliché de
Arisa.
Ellas parecen como su yo usuales, pero
de alguna forma parecen como forzadas, así que les permito a las dos dormir en
mi pecho hoy.
“Arisa–”
“Zzz zzz”
Atrapo la cabeza de Arisa que intenta
deslizarse dentro de mi camisa.
“No dormiré contigo si vas a hacer acoso
sexual.”
“Non nein.”
Aparentemente, Arisa es mas dura de lo
que pensé.
Después de ligeramente pegarle en la
cabeza a Arisa, fuertemente abrazo para dormir así ella no podrá acosarme.
Durante la media noche, Arisa y Lulu
hablan dormidas mientras derraman lágrimas.
Uso magia mental [Buenas Noches] en
ellas y limpio sus lágrimas con mi dedo.
Envió la señal de mano [No Preocuparse]
a Tama y Pochi que parecen en verdad preocupadas.
Las dos asienten y envían la señal [Entendido.]
Juzgando por el movimiento del futon,
las otras chicas parecen preocupadas también.
Estare investigando al señor demonio en
el Sagrado Reino Parion mañana, debería dormirme pronto.
Me gustaría ir al Sagrado Reino Parion
sin algún problema.
◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇

Yuusha no Furi Capitulo 13

Capitulo 13 Torre de Prueba Encuentro Sin Fin

(Segundo Piso)

Descendemos al segundo piso de la Torre de Prueba. Tenemos siete horas y cincuenta minutos hasta la puesta del sol. Los pasillos son hechos de piedras como en el primer piso. Su altura es sin cambio a dos metros, pero es más amplio con tres metros.

Sin embargo, veo una línea blanca en el piso cuando bajamos y suspire en des alivio cuando mire más allá.

“Qué demonios es esto…”

Miro enfrente.

Los monstruos están en multitud juntos a donde sea que mires en el amplio pasillo todo derecho.

【Esqueleto Espada】esqueleto blanco que carga solo una espada. Es débil per ellos vienen en grupos.

【Gargola】estatua de piedra modelada del demonio. Duro.

【Esqueleto Caballero】esqueleto negro armado pesadamente. Duro y rápido.

【Estatua Malvada】 estatuilla de piedra modelada del dios demonio. Dura y fuerte. Continuar leyendo «Yuusha no Furi Capitulo 13»

Death march kara hajimaru isekai kyusoukyoku Capitulo 14-4

Reino Yowok
Satou está aquí. Exterminar pestes en la
granja de mi abuelo fue ya lo suficiente duro, pero en otro mundo las pestes
pueden incluso necesitan un ejército, así que la gente normal no puede hacer
nada sobre ellos. Es como desafiar osos o dinosaurios con herramientas de
granja después de todo.


Al principio estaba vacilando para
elegir que sospecha debería aclarar primero, pero después de contemplar el
fácil movimiento, decido en esta.
En figura de Kuro, voy hacia a una rama
de la Firma Echigoya en el relajado punto en el Condado Kuhanou.
Este lugar es un edificio temporal y no
uno de los ejecutivos aquí.
“Uwah… Espere, ese cabello blanco, ¡¿es
usted Kuro-sama?! Oh por favor no me sorprenda como eso.”
“No importa.”
La gerente de rama que justo vino dentro
de la habitación donde me movi con Mover Unidad fue sorprendida.
Ella es una esclava que la Gerente
compro, pero la Gerente valoro altamente su talento en compras y negociación y
confio a ella ser la gerente de la rama.
Parece le ha prometido ser liberada de
su estado de esclavo si ella puede hacer esta oficina prospera.
Hay algunas personas que no quieren ser
liberadas como Tifaliza, pero la mayoría de ellas quieren ser liberadas de
trabajar, hay algo de amplia diferencia en sus deseos.
“¿Qué asuntos tiene usted hoy? O tal
vez, ¿el reporte que envié ayer llego ya?”
–¿Reporte?
“No, no lo he visto, ¿es eso
importante?”
“No no, es solo que uno de los viñedos
para vinos está al borde de colapsar.”
Qué, ese tipo de cosas huh… No, espera.
“¿Es ese el contenido del reporte?”
“Si, es de la rama de licor que la
Gerente regularmente abastece, así que me gustaría preguntar si debería
intervenir o no.”
“¿Es esta la 『Sangre de Lesseu』?”
“Así que Kuro-sama está al tanto de
esto… Qué tipo de secreto ese vino barato–”
Ligeramente advierto a la gerente de
rama en prueba, “La curiosidad mato al gato.” Este [Sangre de Lesseu] es un
vino que el Verdadero Ancestro vampiro Ban que vive en la capa inferior del
laberinto gusta.
Investigar al señor demonio es
importante, pero no debería ser negligente con esto tampoco.
Él es un amigo después de todo, y estoy
en deuda con el por varias cosas.
“Así que, ¿es la razón del colapso el
financiamiento?”
Si ese es el caso entonces la Firma
Echigoya puede solo comprarlos.
“No, las aldeas donde el vino es
producido parecen estar en peligro de aniquilación debido al desenfreno de
monstruos. El ejército territorial del Conde Lesseu solo extermina monstruos en
las carreteras y las minas, así que las áreas rurales lejos de las ciudades
están terribles.”
Reviso el mapa mientras escucho a la
gerente de rama.
Hay unos pocos monstruos junto al camino
y alrededor de las ciudades donde el ejército del reino fue dicho a limpiar,
pero las áreas rurales donde los monstruos vagan están a punto de volverse
zonas de peligro.
Los monstruos son todos nivel 20, pero
exceptuando a los aldeanos para exterminarlos es imposible.
“¿El nombre de la aldea?”
“Son la aldea Hosbed y villa Suibod.”
Revisando en el mapa, monstruos tipo
hormiga han hecho su nido en la montaña cercana de la aldea Hosbed, mientras
monstruos tipo oruga parecen haberse dispersado alrededor del vecindario de la
villa Suibod.
“Entonces iré a exterminarlos.”
“¿Eh? Kuro-sama–”
Después de decirle a la gerente de rama,
me muevo a la montaña cercana a la aldea Hosbed con magia [Teletransporte].
Con esta magia [Teletransporte] puedo
transportarme a donde sea en el mapa que ha sido explorado, es extremadamente
fácil.
Por supuesto, [Puerta de Teletransporte]
es lo mismo también, pero esa usa demasiado poder mágico.
Creo [Mover Unidad] que puede solo ser
usada en áreas que gobierno y lugares que puedo ver tiene sus casos de uso.
“¡Malditas hormigas bastardas! ¡Nuestros
viñedos en el que pusimos tanto esfuerzo!”
“¡Tagwosa! ¡Detente! ¡Solo morirás en
vano peleando con ellos con una hoz!”
Puedo escuchar tal conversación desde el
flujo del aire desde la aldea.
De acuerdo al radar, parece que el viñedo
que está localizado al pie de la montaña está siendo atacado por monstruos
hormigas.
Saco orbes mágicos de nivel 30 desde el
Almacén y los arrojo al suelo.
–[Crear Lobo de Piedra]
10 lobos de piedra del tamaño de osos
son creados desde el centro de los núcleos mágicos en el suelo.
Estos lobos de piedra son un tipo de
golem.
“Eliminen a los monstruos que atacan la
aldea.”
Después de darles una orden, los lobos
de piedra corren a toda velocidad hacia el viñedo.
Eliminando los monstruos con Flecha Remota
podría ser mejor con el coste, pero pensando sobre el futuro, decidí usar los
lobos de piedra.
La batalla ya ha terminado cuando llegue
al pie de la montaña por caminar tranquilamente.
Los monstruos hormiga solo rondan el
nivel 10, no son desafío contra los lobos de piedra.
Los lobos de piedra, que se han
silenciosamente alineado, ponen los núcleos mágicos que recolectaron de las
hormigas cerca de mis pies.
Son 30 de ellos en total.
Aunque son pequeñeces, esto es demasiado
para un hábitat humano.
¿No habría sido la aldea destruida si no
estuviera aquí?
“¿E-es usted el amo de aquellos lobos de
piedra?”
“Eso es correcto. El nombre es Kuro.”
Le doy a los lobos de piedra la orden de
encargarse del nido de hormigas mientras respondo a los aldeanos.
Hacerlo solo designar el lugar en el
mapa, es en verdad fácil.
“Mago-sama, ¿A dónde aquellos lobos de
piedra van?”
El mayor de la aldea que tiene buenas
ropas aparece desde atrás del hombre que pregunto a mi cortésmente.
“Deje a los lobos de piedra ir a destruir
el nido de hormigas. No puedo entregar estos núcleos mágicos, pero no tomare
los materiales de los cuerpos de aquellos monstruos, distribúyanlos para uso de
los aldeanos.”
Apunto al cuerpo de las hormigas que los
lobos de piedra han destruido y dejado a los aldeanos.
Placas protectoras hechas de coraza de
hormiga tiene buena defensa a pesar de ser tan ligera como armadura de cuero,
así que debería ser vendido a un buen precio a los vendedores de armas ya que
la nación vecina está teniendo una guerra civil.
Uso los núcleos mágicos que justo
conseguí para el [Crear Lobos de Piedra] como antes, creando 30 lobos de piedra
de tamaño de perro mediano.
Son inferiores comparados a los lobos de
piedra de antes, pero ellos deberían ser más fuertes que los soldados promedio.
Debería ser suficiente para la defensa
de la aldea.
Ordeno a los lobos de piedra proteger el
viñedo, y patrullan el vecindario y destruyen cualquier monstruo.
Solo en caso, le otorgo al mayor de la
aldea un derecho de restricción para comandarlos.
“Estoy dándole estos lobos de piedra
para proteger el viñedo. Hagan uso de ellos para exterminar a los monstruos.”
“T-tal costosos sirvientes mágicos, ¿es
esto?”
–¿Costoso? Considerando el precio del
núcleo mágico, todos ellos no valen incluso una moneda de oro ¿saben?
“No me importa. Mis conocidos
habitualmente beben el licor hecho por estas uvas de la aldea. Hago esto por
esa persona.”
“¿E-esto no fue una orden del Conde
Lesseu?”
“No tengo nada que hacer con el Conde
Lesseu, pero él no es de mente cerrada como para quejarse sobre una aldea
siendo salvada por un trato.”
No, ese joven sin modales tal vez se
resienta si la población muestra gratitud a alguien aparte de él.
“Sin embargo, si el Conde Lesseu se
queja, díganle directamente que fue la Casa del Duque Mitsukuni.”
“¡¿C-casa de Duque?! ¿Si-si no me
equivoco, es más grande que el Conde-sama?”
Ignorando la sorpresa del mayor de la
aldea, tallo en los lobos de piedra con la cresta de la casa del Duque
Mitsukuni usando magia.
La cresta de la casa del Duque Mitsukuni
son dos raquetas de tenis intercaladas. Mito probablemente tomo las raquetas
del manga [Teni x Hero] de donde el nombre [Yamato] viene.
> Lobos de Piedra Lideres han
completado la orden. Cambiando a modo espera.
El registro enlista los lobos de piedra
completando su misión.
Esto es bastante conveniente.
“Bueno entonces, adiós.”
Expresandolo uso la magia [Volar] al
cantar, dirigiéndome al nido de hormigas a través del cielo donde los lobos de
piedra están esperando, y recolecto los cuerpos y los núcleos mágicos.
Cuando estaba entrando a la cueva,
invoco la magia [Astro Suit] que una vez use en el cielo vacío, evitando la
peste.
Esta magia tiene muy buena versatilidad.
Usando los núcleos mágicos que conseguí
ahí, salve a la villa y conseguí un montón más de núcleos mágicos.
Por supuesto también deje desplegados
lobos de piedra para proteger la villa como con la aldea, así que los viñedos
deberían ser pacíficos desde ahora.
Ligeramente desanimado, pero ya que hay
aún algo de tiempo antes del mediodía, me dirijo hacia el Reino Yowok a través
de la línea área.
Inadvertidamente me acerco al campo de
batalla cuando estaba pasando a través del Ducado Bishtal junto al camino y fui
perseguido por los Wyverns Riders.
Inmediatamente los perdí una vez cambie
de [Fly] a Flash Drive, pero tengo que ser cuidadoso en elegir mi curso de
vuelo la próxima vez.
Solo en caso, busque en el Ducado
Bishtal, pero no había algún demonio o usuario de Habilidad Única ahí.
Había inusualmente varios Domadores o
Montadores de Bestias pero, no pude encontrar un punto particularmente
sospechoso, así que probablemente es un territorio que ofrece ese tipo de
trabajos.
Había un lago enorme, cinco veces el
tamaño del Lago Biwa cerca de la capital del ducado, me gustaría ir a visitarlo
con todas una vez la guerra termine.
Y entonces, finalmente llego a un grupo
de pequeños reinos después de cruzar la frontera de la montaña.
Hice un ligero error, como no llegue al
Reino Yowok sino a un pueblo de un reino montañoso llamado Reino Zareok.
De acuerdo al documento del Ministerio
de Turismo, parece ser un reino idealizado que se especializa en productos de
lana.
“Fumu, la especialidad de productos aquí
son el bistec de oveja y el licor de leche de oveja huh…”
De acuerdo a la guía gourmet del primer
ministro, el bistec de oveja es soberbio, y una vez deleitas el licor de leche
de oveja, no puedes parar.
Fui ligeramente tentado a tomarlos, pero
vamos a disfrutarlo con todas luego.
Por el propósito de re-visita, construyo
una casa en un lugar desolado profundo en la montaña usando la magia [Crear
Casa Segura].
Es una magia original creada por
remodelar la magia [Crear Casa] desde antes.
El interior es una casa normal, pero
parece como una casa deshabitada cubierta de hiedra en el exterior.
Además, esta oculta en los alrededores
una vez te alejas ligeramente de esto, así que a menos            que tengas algo como mi mapa, o una muy buena suerte,
encontrar este [Retiro] debería ser difícil.
Dejando detrás las tentadoras memorias
del reino Zareok, me dirijo hacia el reino vecino.
Por alguna razón, hay áreas que son
gobernadas por monstruos en la frontera o más bien la brecha entre reinos.
Aparentemente, cuando un fuerte monstruo
sobre cierto nivel continuo gobernando el Origen, el área se vuelve su dominio.
Es como un juego de simulación de gran
estrategia.
Pasando a través de tales monstruos
dominantes, entro al siguiente reino.
De acuerdo al mapa del Ministerio de
Turismo, este es el Reino Garuok donde un montón de trabajos de madera y carbón
existe.
Parece que las estatuillas hechas por el
maestro artesano de este reino son famosas incluso en el Reino Shiga e Imperio
Saga.
“Figurillas huh–Turistear los talleres
de estilo Europeo de figurillas Antique suena divertido.”
De acuerdo al documento, este Reino
Garuok tiene una relación simbiótica con los vecinos pariente Venado y pariente
Ardilla.
Los parientes Venado ofrecen fuerza
militar al Reino Garuok, y consiguen suministro de comida como la compensación.
Mirando al mapa, parece que hay un
montón de parientes Ardilla trabajando lejos de su hogar como artesanos de
figurines.
Hay dominios gobernados por monstruos
entre el Reino Garuok y mi destino el Reino Yowok también.
Este parece ser un domino de wyverns.
Los wyverms encirculan el cielo cerca de
la cima de la montaña encontrándome y elevando gritos vigilantes.
Un wyvern tan grande como un demonio
menor viene junto con varios wyverns con él montando el aire ascendente
actualmente dirigiéndose hacia mi.
Esto lleno de impacto parece como una
escena en una película.
“Wyverns son malas noticias no es así…”
Rápidamente los extermino con magia
[Laser] mientras dejo solo un par de jóvenes wyvern.
La razón de porque no los elimino
completamente es porque los dominios de monstruos tal vez ayudan en restringir
la guerra.
Estaba interesado con el pico blanco
cerca del nido de wyverns, así que voy a ver mientras también recolecto los
cuerpos en el aire.
“Todas estas cosas blancas son las
piedras de dragón blanco huh.”
Aparentemente, las piedras de dragón
blanco son creadas por las heces de wyvern que han cambiado bajo tierra.
Es interesante que el material que viene
de wyverns que carga veneno fatal es también un ingrediente del antídoto
multi-propósito.
Uso magia de tierra para rudamente
cortar la piedra de dragón blanco y las colecto dentro del Almacén.
Con esta cantidad, podría ser al menos
1000 años para uso de ciudad laberinto.
Después de finalmente llegar al Reino
Yowok, uso [Exploración de Mapa Completo].
Ya que este Reino Yowok ha absorbido la
tierra natal de Arisa, es más grande que los pequeños reinos que he visto hasta
ahora, hay dos ciudades y siete pueblos.
Hay duramente algún demi-humano e
incluso esclavos, parece ser un reino que es principalmente de humanos.
Justo como los mapas que he traído desde
lejos, dejando de lado al señor demonio, no hay incluso algún demonio ni
alguien con Habilidad Única.
Por supuesto, ni uno con condición de
posesión o síntomas de señor demonio tampoco.
Los ojos dicen que fue visto el demonio
en el laberinto después de todo, juzgar eso como un reporte falso es demasiado
pronto.
Construyo un [Retiro] en una montaña
para uso de emergencia.
Ya he construido algunas en los reinos
vecinos y el dominio wyvern, pero solo en caso.
Mientras bajo la habilidad [Camuflaje
Optico], me dirijo hacia las ruinas del castillo real del Reino Kubooku donde
el laberinto del Reino Yowok esta.
“Esto es terrible…”
La parte principal del castillo real ha
desaparecido, y tres torres al lado de la pared del castillo han colapsado.
La única torre restante está destruida
en su base también y no hay nadie dentro.
De acuerdo a Arisa, fue el ataque de un
gran demonio, así que el daño tal vez sea un poco considerando.
Ciudad Lesseu fue virtualmente destruida
por un demonio medio después de todo.
Ahora bien, hay unas pocas presencias
humanas en el sitio de este castillo en ruinas.
De acuerdo a la info del mapa, aquellas
gentes tienen la ocupación [Aventurero].
Para ser exacto, ellos parecen ser
[Aventureros] que están en [Gremio de Aventureros del Laberinto Sepultado del
Reino Yowok].
Parece que la gente manejándolo va
dentro y fuera del castillo real, o más bien 
al laberinto a través del edificio [Gremio de Aventureros] localizado en
una sección del sitio del castillo.
Observándolos, veo que los miembros de
personal están revisando la medalla de aventurero en la entrada del laberinto.
Puedo entrar al laberinto si solo uso
[Camuflaje Óptico] y [Camuflaje de Esencia Mágica], pero ya que parece que la
medalla de aventurero es asunto del mismo día justo como en la ciudad laberinto
Selbira, decido ir a través de la ruta normal.
Aterrizo en una sombra cercana al
castillo en ruinas y libero la habilidad [Camuflaje Óptico].
“Hey hey, el onii-san de ahí, ¿quieres
jugar con               Kuku?”
Una pequeña niña de edad de escuela
media intenta tomarme cuando salgo fuera de las sombras.
El poder del rostro de una celebridad
extranjera es asombrosa. Hombres apuestos debería explotar–es al nivel donde
quieres decir eso.
Justo como Arisa ha dicho, el lenguaje
de este reino se siente como el dialecto del Reino Shiga.
“¿Qué hay sobre eso? ¿Solo una pequeña
moneda de plata ya vez?”
Aparentemente, ella no está tomándome a
mí, sino vendiéndose a si misma.
No tengo moneda de este reino, pero
debería ser usable la del Imperio Saga y Reino Shiga.
No es como no pueda pagar, pero la chica
es demasiado joven para venderse a si misma.
“Lo siento, pero no tengo interés en las
pequeñas niñas.”
Cuando estoy a punto de dejarle después
de decir así, dos chicos de aspecto malos aparecen desde la calle opuesta.
“¡Ooh! ¿Ya quieres irte libre después de
poner tus manos en nuestra Kuku?”
“Hehhee, te dejaremos ir con tu vida si
dejas todo tu dinero ¿muy bien?”
Ellos vinieron fuera un poco rápido,
pero parece que estos tipos juegan al juego del engaño.
“En otras palabras, puedo irme si los
derroto ¿huh?”
“¡Hmph! Ya crees ya puede ganar contra
estos hermanos Jido Bado–”
Ya que los dos chicos afirman mi
pregunta, ligeramente los pateo fuera.
Ellos se hunden en una pared de una casa
desierta, pero ya que la pequeña niña llamada Kuku fue hacia ellos, dejarlos
debería estar bien.
“¿Registrarse dice? Entonces por favor
ponga sus manos en este pizarrón de juicio y diga su nombre.”
Cuando pregunta a la hermosa
recepcionista del Gremio de Aventureros, fui hecho a tocar una Piedra Yamato
llamada pizarrón de juicio.
Pensé en usar el nivel de Kuro, pero
parece que nivel 50 podría hacerlos ponerse en guardia, así que reduje al nivel
20 antes de tocar la Piedra Yamato.
Se ve antinatural si fuera a mano vacía
como siempre, así que actualmente estoy equipado con una espada corta de hierro
en mi cintura.
“¿Esta esto bien?”
“¡Mi! ¡Nivel 20, eres asombroso!
¡Además, no solo tiene la habilidad espada de una mano, también tiene incluso
habilidad mágica!”
La recepcionista dice eso en voz fuerte
al mismo tiempo que mis niveles y habilidades aparecen en la Piedra Yamato.
–Qué hay sobre el deber de
confidencialidad.
“Oy.”
“¡Aah, lo siento! Oh mí.”
Juzgando por la recepcionista que no
parece como en verdad lo siente, más bien parece ser descuidada, parece que
ella lo hizo deliberadamente para informar a los espías del Reino Yowok en este
lugar.
Incluso después de tomar la medalla
aventurero y dejar el gremio, aquellos espías no hicieron algún movimiento, así
que parece que estoy fuera del anzuelo de su vigilancia.
Muestro la medalla aventurero escrito
con F en la entrada del laberinto.
Parece que la medalla aventurero usa el
alfabeto A-F debido a la influencia del héroe saga de la primera generación.
Aparentemente es la tradición usar el
rango “Alfabeto” que él uso en el Primer Gremio Aventurero del Imperio Saga que
construyo.
“Hmph, rango F huh. Detente con los
goblin en el primer piso. Goblin mago y goblin montado aparecen en el quinto
piso. No te acerques a ellos, ¿morirás sabes?”
“Gracias por el consejo.”
El guardia de la puerta con tono arrogante
ofrece un amable consejo.
Después de agradecerle al guardia, pongo
pies dentro del laberinto.
Oscuro. Parece que el piso no está
emitiendo luz tenue aquí a diferencia de los laberintos en las ciudades de
Selbira y Seryuu.
Se siente como el laberinto en ruinas en
la Capital del Ducado a pesar.
El nombre del laberinto es [Laberinto
Goblin: Ruinas] después de todo.
De acuerdo a Arisa, parece ser un
laberinto que perdió una vez su Núcleo Calabozo y fue revivido, probablemente
varias funciones no han sido restauradas aún.
Después de caminar por un poco, obtengo
la información del laberinto con [Exploración de Mapa Completo].
Parece que son alrededor de 51 pisos.
Cada piso es cerca de tres veces tan grande como las esquinas del [Laberinto
del Demonio] en Ciudad Seryuu.
–Encontrado.
Hay un señor demonio en el piso inferior
como el [Maestro de Calabozo].
¡Ahora bien, vamos a hacer esto rápido!
La comida que Lulu especialmente hizo
podría enfriarse si no limpio esto rápido después de todo.
◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇

Devil Princess Cap. 09

Bien seguimos con Yuru.


Editor: Alphard(Dealdeus)


 

Capitulo 09: Me Convertí en una Estudiante de Segundo Grado, Parte 02

 

 

Los compañeros de clase de Yurushia en la academia de mágica, llevaban vidas llenas de estrés casi todos los días.

 

Comenzó con la ceremonia de entrada del primer año.

 

Ya siendo llamada una [Santa] antes de entrar a la escuela, la nieta del rey y también la hija de un duque, esa era la [Princesa] que fungía como el rostro del reino.

Sólo oír hablar, de una persona semejante a un dios ya los hacía sentir mareos, los estudiantes plebeyos la admiraban sin importarles su temor, mientras que a los hijos de los nobles se les advertía con dureza que no cometieran un error delante de ella, por lo que todo el mundo estaba nervioso por el hecho de tener que aprender junto a ella.

Incluso los niños que no eran religiosos la adoraban.

Una niña de su misma edad, que tenía un nivel de poder mágico que podía hacer que los adultos clamaran de admiración, que poseía una [Belleza] de la que incluso los adultos estaban asombrados, casi era como una historia de cuentos de hadas.

 

El día de la ceremonia de entrada a la academia de magia.

Acompañada por sus padres, el duque de Verusenia y su esposa, caminando como una [Princesa] rodeada por sus sirvientes y caballeros de escolta, no sólo los nuevos estudiantes, sino incluso los estudiantes superiores fueron cautivados a partir de ese momento.

Ella era la misma imagen de una hermosa [Princesa] de cuentos de hadas, de la cual todos habían leído desde niños.

Algunos susurraron [Angel-sama], se olvidaron de respirar, y se desmayaron a sus pies.

Los que no habían generado ninguna resistencia hacia ella, se congelaron un poco después de que pasara junto a ellos. Finalmente, los profesores salieron de su trance y comenzaron a sacar de su trance a los nuevos estudiantes.

 

Durante el discurso de apertura del representante de primer año, todos dejaron escapar un suspiro de alivio cuando vieron que Yurushia estaba teniendo dificultades para dar su discurso por la vergüenza.

Ver que esa perfecta [Princesa] era también [Humana], como todos los demás, hizo que todos agradecieran a los dioses dentro de sus corazones.

Aun así, parece que [Dios] la amaba especialmente.

Porque en el instante en que ella giro sus ojos compasivos hacia los estudiantes, una cantidad inimaginable de [Ángeles de Luz] y [Arcángeles de luz] se manifestó, y siendo que, para muchos de los presentes, esta era la primera vez que experimentaban【Protección Divina Mayor】, a algunos de ellos les dio fiebre, mientras que otros quedaron traumatizados.

La Princesa es aterradora.

 

Aunque había muchos grupos y ya que los estudiantes iban a clases diferentes para tomar sus lecciones, la división entre estas, no cambiaba nada a excepción sobre quién sería el profesor del salón para ese grupo.

Pero ya que los grados inferiores, tienen en su mayoría clases de nivel general en su currículo, los compañeros de clase de Yurushia tendrían que, inevitablemente pasar mucho tiempo con ella.

Esos compañeros de clase fueron capaces de acostumbrarse a la belleza de Yurushia con relativa rapidez.

Yurushia, poseía la belleza fría de una muñeca, pero por dentro era considerablemente [Gentil], hacia posible que ellos mantuvieran la calma siempre y cuando, no la miraran directamente.

Aparte de eso, su [Forma de Dirigírsele] fue el siguiente obstáculo.

No había manera de que un plebeyo pudiera simplemente hablarle a la hija de una casa Ducal y aunque las hijas e hijos nobles trataron de hablar con ella, las dos sirvientes que la acompañaban en la misma clase, siempre mantenían una mirada vigilante sobre ellos.

Cualquiera que tratara de acercarse a Yurushia era eliminado por las dos chicas como si fueran insectos y eran silenciosamente [Intimidados] desde lejos.

Aunque unas cuantas personas súper M se ruborizaban bajo sus miradas, esos tipos eran raros, por lo que la mayoría de la clase era incapaz de hablar con ella.

 

También había momentos en los que Yurushia venía a clase sola.

Cuando los compañeros de clase, que se habían acostumbrado a Yurushia, la llamaban [Princesa-sama] a sus espaldas, y se intercambiaban miradas entre sí, [Él] apareció.

El primo de Yurushia, el segundo príncipe del reino, Roderick, él a menudo venía a visitarla.

Cuando eso sucedía, se volvía difícil hablar con ella, pero en un sentido diferente.

Aunque Yurushia lo llama [Nii-san], los dos no eran hermanos.

Ver a los geniales [Príncipe-sama] y [Princesa-sama] juntos era exactamente como presenciar una escena de un cuento de hadas, las alumnas se retorcían diciendo * kyaa kyaa * deleitadas.

Sus delirios habían progresado hasta el punto de que el chico al que la chica llamaba [Nii-san], no la trataba como una [Hermana] sino como una [Mujer].

 

Aunque querían hablar, no podían, ya que estaban abrumados por la pura [Presencia] de Yurushia en el aula. Puesto que no querían cambiar de clase. Con tal de mantener sus calificaciones y quedarse como los compañeros de clase de la [Princesa-sama], ellos redujeron sus tiempos de sueño para dedicarlos a estudiar.

Más retos les esperaban a sus compañeros.

Al principio estaban encantados. Después del trauma que se puso en ellos en la ceremonia de entrada de forma involuntaria y automática, el [Miedo] a Yurushia se había alejado gradualmente.

Al igual que la gente que la rodeaba, ella también estaba contenta de que finalmente había llegado a esa etapa, pero se dio cuenta de que era un error.

 

Aunque era una historia que sólo ella conocía, recordó la época cuando solamente tenía dos años.

Que ella sería [Una hermosa flor a los 10 años]………

La raíz de otro de los [Miedos] de Yurushia era la pura [Presencia], que provenía de su enorme poder mágico como Demonio.

Ese [Miedo] vino de la diferencia.

Una belleza abrumadora y una fuerte presencia que se reflejaba en su intensa mirada, todo dentro en un adorable bebé, era demasiado antinatural.

Para decirlo de una manera extrema, sería como un niño mostrando un cuchillo de cocina a los adultos en un parque.

 

A medida que se acercaba a los nueve años, se había vuelto más grande, y su cuerpo también había adquirido una suave redondez, transformándose de una niña en una [joven Dama]. La anti naturalidad comenzó a desvanecerse, y en lugar de la apariencia [Temible] era una deslumbrante [Belleza].

 

No fueron sus amigos o familiares los primeros que sintieron el [Cambio] en Yurushia, sino sus compañeros de clase.

 

Ellos querían hablar con ella, pero no podían……… sin embargo. La razón era diferente a la de antes.

Gracias al alivio del miedo, pudieron intercambiar saludos con ella, pero no pudieron avanzar más de allí.

Le devolvían sus saludos, pero sus rostros se ruborizaban cuando la veían sonreír y sus corazones se aceleraban, marcando con eso, el final de la conversación.

 

Nunca podría imaginar, qué es lo que sus compañeros de clase estaban pensando.

Antes de que pudieran acostumbrarse, ya habían sido [Fascinados] por su misma existencia.

 

Pronto tendría nueve años.

Más hermosa que el año anterior, y sería más hermosa al siguiente.

Faltaban aun, ocho años más, antes de que ella se graduara de la academia. Y sus compañeros de clase, pasaban todos sus días con estos duros, dolorosos y, sin embargo, [Dulces] momentos.

Entonces, ellos pensaron.

En este momento… espero poder hacerme amigo de la [Princesa-sama].

 


Nota del Autor:

Esto fue una ronda de explicaciones para la situación actual. Fue un poco corto.


 

 

Devil Princess Cap. 08

Bien seguimos con Yuru como dije en la tarde la siguiente semana saldrán los caps normalmente.

 


Editor: Alphard(Dealdeus)


 

Capítulo 08: Me convertí en una Estudiante de Segundo Grado, Parte 01

 

 

El año ha cambiado, las estaciones también han cambiado, me he convertido en una estudiante de segundo grado en la academia de magia y cumpliré nueve años en pocos meses.

Estoy en el mismo grado que una cierta chica que usa un cañón-mágico.[1]

No puedo ser llamada una niña más.

…… ¿Debería [Transformarme] yo también?

Pero, si me transformo en una de esas tan llamadas ‘chicas mágicas’, me preocuparía qué hacer con mi [Segunda Transformación].

 

Bueno~, aunque me siento atraída por la idea, dejando eso de lado por el momento, mi vida como estudiante de segundo año no ha cambiado mucho.

Salgo a jugar con Shelly y Betty, teniendo fiestas de té con ellas como siempre.

Si tuviera que hablar de cosas que son un poco inusuales, sería que mis compañeros de clase parecen haberse acostumbrado a mí, y finalmente hemos llegado al punto donde intercambiamos saludos.

…… He sufrido durante casi dos años por esto.

Aunque hablo regularmente con mis sirvientes y recibo cartas de ellos, esto se siente muy diferente por alguna razón.

Incluso si le pido a Shelly que me explique:

[Yuru-sama es tan linda que es un crimen.]

 

 

De todos modos, además de todo eso, los incidentes del [Mocoso de Mierda Rick-chan] parecen haberse establecido por el momento, al menos en la superficie.

Aunque he sido cuidadosa al respecto, ya que no hubo ningún evento especial de confesión, mi actitud no ha cambiado, podría haber sido mi malentendido, después de todo.

… ese bribón… jugando con los sentimientos de una doncella, qué imperdonable.

Pero gracias a Dios que no me preguntó… Si me hubiera descuidado, podría haber habido un [Bebe Dolorido] que habría cometido algún error de nuevo. Qué peligroso, qué peligroso.

Aunque todavía me siento un poco deprimida…

 

 

[Yurushia]

 

 

Mientras arrastraba a Tina del salón conmigo, para saltarme lecciones, alguien que me llamaba sin honoríficos, me detuvo.

Sólo había una [Persona] que haría ese tipo de cosas en esta escuela.

[……Rick.]

Aunque Rick era básicamente un [Bastardo que se Auto-Vanagloriaba], que normalmente deja a sus sirvientes detrás y que groseramente se mete en las cosas donde no lo llaman, estos días, él ha sido bastante diferente.

Al igual que los valientes guerreros que tiran de un [Tren] perseguido por monstruos, Rick está rodeado de olas y olas de chicas.

Oh, aumentó de nuevo.

… Aparentemente. No me enojan esas cosas.

Estoy un poco resentida de que a pesar de que todavía es un mocoso, cuando cumplió 12 años y se convirtió en un [Hombre Joven], su altura rápidamente se disparó hasta 170 cm, y ahora es totalmente, una cabeza más alto que yo.

[………]

 

 

[Yurushi…]

Cuando Rick se acercó a mí, mi cara se estrechó momentáneamente y sus pies se detuvieron.

Las chicas que lo seguían de cerca y que finalmente lo alcanzaron. Estaban sin aliento, pero al oír a Rick gritar, se congelaron.

[…Roderick-nii-sama.]

[…O, oh]

Chicas, ¿De qué tienen tanto miedo? Aunque sé que soy una persona temida, todas las chicas estaban mirando con la boca abierta. Mirando fijamente, sus caras estaban tan rojas que pareciera que estuvieran enfermas, me estremecí sutilmente por lo extraño que me parecían.

[…… ¿En qué puedo ayudarles a todas?]

Cuando llamé a las chicas y volteé a mirarlas a todas ellas, con lo que parece que fueron liberadas de su parálisis, y todas se retiraron como la marea.

¿Eh? ¿Estaba intimidándolas?

 

 

[T-tú, ven aquí un minuto…]

[Eh…]

Rick agarró mi brazo con el rostro sombrío y comenzó a caminar rápidamente, dejando a las chicas detrás.

[… Una vez más, tomas mi brazo…]

[Cállate]

¿Qué es, ya…? … Tina, quien por lo general hace un escándalo acerca de esas cosas, esta terriblemente tranquila… o eso pensé, pero mientras nos seguía, Tina ponía cara peligrosa.

 

 

En el salón al que sólo los nobles de clase alta podían acceder, y después de confirmar que no había nadie por aquí, Rick me miró a los ojos.

[Yurushia… tú, ¿por qué te estás volviendo tan inexpresiva?]

[… ¿Eh?]

¿Inexpresiva? Aunque Rick estaba acostumbrado a [Mi] y a mi rostro; ¿Ya que todos los demás no que lo están, eso les causaba temor…? Mmm

Aunque no lo entiendo bien, me di cuenta de que estaba actuando un poco [Inhumana], así que me froté las mejillas con un * munimuni * y respiré hondo y Rick dio un suspiro de alivio.

¿Ya está bien? Mirando a Tina, ella asintió con la cabeza * kokukoku * en alivio también.

 

 

[…… Por fin, regresaste a la Yurushia normal.]

[… ¿Qué tipo de rostro tiene la ‘habitual yo’?]

[Aahh~… ¿Una cara soñolienta…?]

Qué diablos. ¿Por qué fue una pregunta?

[¿Has estado de mal humor…?]

[……No entiendo]

Me pregunto ¿cuál es realmente el problema? Incluso yo misma no lo sé.

Ya veo. Este chico que es bastante molesto, pero lindo, se volvió un poco frío y con eso ahora es el tipo de niño samurái, fue así como sedujo a las chicas. Sí.

[Es porque Rick se ha convertido en un chico malo.]

[¡¿Qué diablos!?]

Muuu… ¿estás intentando fingir ignorancia?

[¿No has estado caminando con una gran cantidad de chicas?]

[¡No las conozco! Aparecieron solas. Ah~…]

[¿…?]

Aunque Rick se indignó, mientras incliné la cabeza hacia un lado, sus labios se tensaron. Me siento mal.

 

 

[Por cierto, Rick…… ¿Puedes soltar mi brazo ya?]

[………]

Rick finalmente parece haber notado que había estado sosteniendo mi brazo todo este tiempo.

Al haberlo sujetado con toda su fuerza… Esto podría convertirse en un moretón. Este tipo es muy dominante, en serio.

[No, tengo negocios contigo. Acompáñame por un rato.]

[Eh, ¿qué?]

Rick fue directamente a un salón cercano, y al final, no soltó mi brazo hasta que llegamos.

Eh, ¿podría ser? ¿Tendrá algún tipo de pasatiempo de controlador…?

 

 

 

 

En el salón, se oía el sonido de un piano que se tocaba en silencio.

Era una melodía tranquila que me hizo querer dormir, una melodía que me gustó.

[………]

Por alguna razón, estoy sola con Rick, escuchándolo tocar el piano… ¿por qué?

El té que bebo mientras estoy sentada en una silla, no fue hecho por mí, sino por él. Estoy extrañamente molesta de que sea tan hábil en esto.

¿Es detestable? ¿Es detestable que tenga esta torpe habilidad? Me disguste.

Justo ahora, Tina se encuentra fuera del salón, liberando una intensa sed de sangre, me pregunto si está bien…

 

[…No te quedes dormida, Yurushia.]

La música se detuvo repentinamente, y Rick dijo algo grosero.

[……No estoy durmiendo.]

Yo sólo tenía un poco de sueño, ¿sabes?

Asegurándose de que no estaba durmiendo, Rick sonrió y se apartó del piano, caminando hacia mí.

[¿Te has calmado?]

[… ¿Qué?]

[………]

Ahh~… Ya veo. Como pensé, cuando mi estado de ánimo es malo tengo una cara aterradora.

Aunque ahora estoy tan tranquila como estoy normalmente, mi ánimo no sube y baja tan intensamente como el de un ser humano en primer lugar… bueno, probablemente.

 

[… Ah, oh bien. Dejando eso de lado, Yurushia. ¿Sabías que hay una nueva catedral de la religión Kostoru en el territorio de Colto?]

Rick se sentó ligeramente junto a mí, soltó un suspiro y finalmente llegó al tema principal.

[¿Catedral…?]

[Así es. Para esta quinta catedral de Tariterudo[2], el señor del territorio puso la mitad del presupuesto para su construcción.]

¿El país puso el presupuesto correcto…? … ¿Está realmente bien? ¿Es porque es la religión del estado? Después de todo, no imponemos la separación de la iglesia y el estado.

[¿Que pasó…?]

[No, nada ha sucedido hasta ahora…. Pero mañana o al día siguiente, el honorable Tío… El Duque Verusenia pensó en declarar a Yurushia la Santa de la nueva generación y como la [Princesa] del Reino Santo junto con el nuevo Arzobispo y el señor de allá, él quiere que tú vayas.]

[… ¿Haah?]

¡Qué manera de preguntar! …… es difícil.

[Así que voy, y luego… ¿qué se supone que debo hacer?]

[Bueno… Parece probable que quieran que los residentes del territorio vean tu Magia Sagrada, para que puedas curar a los heridos graves y a los enfermos, y para predicar y reclutar, a la gente durante mucho tiempo… Es bastante irrazonable.]

[Muuu…]

Qué detestable… y estúpido. Pero.

[No es para siempre, ¿verdad? ¿Cuánto tiempo?]

[Aunque el otro lado esperaba un año, es hasta la conveniencia de Yurushia. Generalmente duraría alrededor de varias semanas.]

Por supuesto que voy a rechazar si es un año, pero ¿qué pasa con varias semanas?

Estaba un poco interesada en lo que dijo, pero luego vi la cara de Rick.

[Si ese es el caso… ¿por qué me estás hablando de esto ahora, Rick?]

Si eso era lo único, no habría necesidad de que Rick me llevara al salón solo para hablar. ¿Cuáles eran las otras razones? Mientras lo miraba con curiosidad, Rick parecía extraño.

[Uh, um, bueno… ¿Es porque eres la hija de un Duque? Más o menos.]

[¿Qué… qué?]

[El territorio de Colto……… Es el territorio del Duque Kaperu.]

[A…Aah~]

El que tiene terribles relaciones con la Casa Verusenia, la Casa Kaperu.

[Lo siento, no había pensado en eso.]

[………]

El rostro de Rick se hizo aún más extraño…. Me pregunto si es una cara de resignación.

[De todas formas. Parece que el honorable Tío, no quiere que vayas a ese lugar. Sin embargo, como el asunto concierne a la nación, y es una solicitud formal para la [Princesa], eso es algo que no puedes ignorar, si es que dicen, que quieren que Yurushia vaya.]

[…Sí]

 

Es sospechoso que el Duque Kaperu me esté llamando específicamente. Pero no puedo rechazarlo porque soy la [Princesa] y recibo tratamiento como el de un miembro de la familia real. Como parte de la familia real, no puedo simplemente rechazarlos con la excusa de que [Es sospechoso].

Bueno, eso es enteramente culpa del abuelo-sama.

Además, si he oído bien, el horario coincide exactamente para cuando papá valla al mar por negocios.

Wow… qué descarados. Me estoy poniendo un poco emocionada ahora.

Y el nuevo [Arzobispo] también…

 

[Por lo tanto, cuando Yurushia vaya, yo iré también.]

[…… ¿Eh?]

¿Por qué?

[Yo sé que Yurushia tiene más que suficiente [Poder] para ser llamada una Santa. Pero creo que el peligro no es hacia tu [Vida], sino más bien a tu [Reputación] y a tu [Espíritu]. Si voy contigo, no podrán jugar su mano tan fácilmente.]

 

De hecho, aunque sea el Duque Kaperu, no creo que sea tan tonto como para apuntar a mi vida cuando soy tan querida por el abuelo-sama, o sea, Su Majestad el Rey.

Por lo tanto, como dijo Rick, es muy probable que esté apuntando a la [Reputación] y al [Honor] de la Casa Verusenia, y tenga la intención de atormentar mi [Corazón].

Aunque, ese es mi plato favorito para servirme………

 

[………]

Rick se quedó en silencio y me miró con ojos serios.

Si dice que estoy en peligro, entonces Rick, quien me protegería, ¿También estará en peligro?

… El que me mires con esos ojos, ha causado que varias chicas hayan comenzado a malinterpretar nuestra relación.

No se puede evitar………

Rick… te protegeré.

 


Nota del autor: Como siempre, gracias por señalar mis errores.


 

Notas:

[1] Referencia a Mahou Shoujo Lyrical Nanoha.

[2] Así estaba según yo era Taterudo no sé si le cambiaron el nombre o se equivocaron estos pinches gringos

 

Choujin Koukousei-tachi Precuela

Ok lo prometido es deuda empezamos con esta novela que promete bastante sobre yuru gomen pero como había dicho no tuve mucho tiempo la siguiente semana saldrán los caps normalmente con eso aquí la precuela…

Pre-cuela – 7 Super Estudiantes de Preparatoria

En Japón, existen 7 estudiantes de preparatoria que conmocionaron al mundo.

――El primero, manejando una katana para proteger a la gente débil en áreas de conflicto en el Medio Oriente, un samurai moderno――

[¡Mierda! ¡Dispara! ¡Dispara y mátala!]

[¡No es bueno! Ella es demasiado rápida, no puedo… GYYAAAA!]

Con su largo cabello que se balancea detrás de ella, una chica llegó rápidamente como el viento en el desierto lleno de balas. Y ella se precipitó en la línea de los soldados, matándolos inmediatamente con su katana y creando una sangrienta carnicería. Los soldados confundidos apuntaron sus armas a la chica, pero golpearon solamente a sus aliados, mientras que la chica salió indemne.

[¡…… Esto imposible ……! ¡¿Una tropa totalmente armada fue aniquilada, por una chica que solo sostenía una espada como oponente…… !?]

La chica miró con animosidad al comandante que temblaba de miedo.

[Cobarde, aterrorizando a mujeres y niños impotentes con armas y violencia, esta espada nunca perdonará a terroristas como tú.]

[¡Hi, hiiiiii!]

[¡Serás puesto a la espada!][1]

――Su nombre es Ichijou Aoi. Ella es la espadachín más fuerte del mundo mientras todavía esta en la preparatoria.

Cargo en el campo de batalla donde vuelan las balas con solo una espada, pateó a los enemigos armados con armamentos modernos, como los héroes de una historia de fantasía.

――El segundo, tratando a los refugiados en un campamento cerca del campo de batalla donde estaba Aoi――

[¡¡¡¡¡Duele!!!!! ¡Ahhhh! ¡¡¡Estoy muriendo!!!]

“[Ouch! Manten los pies firmemente!]

[¡S-sí!]

[Parece que esta bien si está alborotándose tanto sólo por recibir un disparo. Pero si le gusta esto no puede ser tratado. Vamos a hacerle callar con anestesia.]

[¡Doctor! ¡¿Este campamento ya no tiene morfina……!?]

[No hay necesidad de eso.]

De repente, el paciente que estaba en apuros debido al dolor, comenzó a mostrar una expresión relajada.

[Esto, esto es……]

[Manipulé su secreción de endorfina con una aguja. Esto durará 8 horas. Usted puede hacer el procedimiento de extracción de las balas y costura por si mismo ¿verdad?]

[¡S-sí!]

[Entonces, ya que los pacientes con lesiones menores también necesitan inyecciones de anestesia, dejaré el resto a usted. Cuidaré a los pacientes gravemente heridos. Aah, también, trae partes de cadáveres de soldados cuando vayas a recoger Aoi. Quiero usarlos para la transfusión de sangre y órganos.]

[¿Es eso, correcto doctor? Eticamente, quiero decir…]

La misma trabajadora de la ONG[2] que ella preguntó con cara pálida. La chica ensangrentada respondió con una sonrisa gentil e inquebrantable, a pesar de estar en el campo de refugiados donde la sangre salpicaba y gritaba como si estuvieran en el infierno.

[Lo hemos decidido, ¿no? Salvar vidas es más importante que algún sentido de la ética.]

――Su nombre es Kanzaki Keine. Ella es la mejor médico del mundo, mientras todavía esta en la preparatoria.

A pesar de que no hay enfermedades que no puede curar, siempre pensó que la frontera de la vida y la muerte es muy delgada.

――El tercero, un pequeño chico estaba flotando frente al símbolo del país de la libertad――

Una persona misteriosa que lleva un sombrero y un manto de seda, también una máscara brillante para los ojos tratando de ocultar su rostro, flotando por encima de la Estatua de la Libertad que estaba cubierta con una manta, agitó su bastón. El helicóptero que estaba cerca levantó la manta después de ese movimiento, y la figura de la diosa había desaparecido. La multitud que se reunió en Nueva York estaba entusiasmada.

[¡Eso, eso es imposible!]

[¡Oh Dios mío! ¡La Estatua de la Libertad se ha ido!]

[¿Qué, qué sucedió !! ¡El Príncipe Akatsuki logró deslizarse por el ejército estadounidense y el satélite de vigilancia militar e hizo desaparecer la Estatua de la Libertad! Incluso el presidente perdió frente a este desafío!]

La misteriosa persona gira su manto y deja salir una risa distorsionada que no puede esconder su voz infantil cuando oyen la voz del narrador del megáfono.

[Fuahaha! ¡No hay trucos ni artilugios en mi magia! ¡Si es por unos militares o un satélite, mi magia no puede ser detenida! ¿Debo hacer que la Casa Blanca también desaparezca?]

Su nombre es Príncipe Akatsuki. Él es el mejor mago del mundo mientras todavía esta en la preparatoria.

Clarividencia, telequinesis, tele-transportación, aerotransporte. Era un ilusionista que puede hacer cualquier cosa. Sus compañeros en el mismo campo todavía no pueden ver los trucos detrás de su ilusión que hizo 10 millones de yenes durante la noche.

――La cuarta, una chica encerrada dentro de un laboratorio con una tenue luz――

[Ringo-chan Ringo-chan!]

[Nnn~…… ¿Qué es, Kumausa? Ahora mismo estoy haciendo el ajuste final para el programa de división celular del biometal, así que quiero concentrarme……]

[Ahora no es el momento para eso~ kuma. ¿No es el día prometido en sólo dos días más~ kuma? Todos ustedes todavía tienen que hacer la revisión de vuelo, así que si no volvemos a la Tierra pronto, llegaremos tarde~ kuma.]

[Oh… es cierto. Fui descuidada ya que no hay día ni noche aquí.]

La chica se quitó sus grandes gafas y echó un vistazo afuera de la ventana mientras decía eso. Allí, en el vasto océano de estrellas… El gran planeta azul. Aquí estaba la estación espacial personal hecha por la chica en la órbita del satélite.

[Uno de sus malos hábitos es que cuando se sumerge en algo pierde de vista su entorno~ kuma. Por favor corrija eso~ kuma.]

[Hmph. No está bien. Hice a Kumausa con gestión de IA porque entendí eso. Si lo soluciono, Kumausa será desinstalado, ¿sabes?]

[¡¿ Kuma !? Tch, eso es un problema~ kuma. Ringo-chan está bien, ya que es ~kuma.]

[Jaja. Sólo bromeo. Entonces Kumausa, llévame al Puerto Tanegashima en Japón, ¿quieres?]

[¡Kuma! ¡No hay problema Kuma!]

[…… Me pregunto cómo…… Tsukasa lo está haciendo……]

――Su nombre es Oohoshi Ringo. Ella es la mejor inventora del mundo mientras todavía esta en la preparatoria.

Teniendo un cerebro que esta siglos adelantado, había creado toda la ciencia y tecnología que ahora apoyaban al mundo, como el “pequeño reactor nuclear de fisión”, el “metal líquido” y la “desintoxicación completa de desechos radiactivos” por ella misma. Agentes de muchos países siempre estaban apuntando a ella porque el valor de su cerebro ya está más allá del nivel estratégico nacional, por lo que normalmente pasaba la mayor parte de su tiempo trabajando en el laboratorio de la estación espacial.

――El Quinto, un chico esta teniendo una cena con una hermosa mujer en un restaurante donde se puede mirar completamente la vista nocturna de Las Vegas――

[Kelly. Estoy verdaderamente agradecido de poder monopolizar tu sonrisa que puede fascinar a todo el país.]

[¿De verdad piensas eso?]

[Por supuesto. No puedo mentirle a tu belleza, cariño.]

[……. Si realmente piensas así, ¿podrías dejar ese teléfono?]

* Stare * La joven actriz que ha enamorado a todos los hombres del país miró al chico sin ocultar su disgusto. Eso es dado. A pesar de que los hors d’oeuvres[3] habían sido servidos, varios teléfonos inteligentes todavía se encuentran alineados delante del chico, y en su oído todavía tiene un intercomunicador.

[Ow, lo siento. Perdóname, Kelly. Justo ahora es el momento decisivo de la economía japonesa. No puedo quitarle los ojos, espera, disculpa……. – aahh sí. Compramos el grupo Torezo. Está bien. El presidente Aramaki nunca abandonará al grupo de Torezo. Tiene un fuerte sentido del deber y de humanidad. Pase a través de la solicitud – Oh, espera un segundo. Es Sarutobi. Ah, no tienes que colgar. Sólo mantente conectado y espera un rato. …… ¿Qué es? ¿Ha? ¡¿ El presupuesto ha sido aprobado !? ¡Un adicional de 10.000 millones de yenes! ¡Jaja! ¡BIEN BIEN! Es un poco aburrido cómo todo cayó dentro de mis expectativas. ¿Hm? Ah, ya entiendo. Planeaba regresarles mi agradecimiento correctamente. También informó correctamente el acuerdo así que apenas esté en la facilidad* (esta ultima le fallo al gringo pedía ayuda aquí xD). Nos vemos. – ¿Escuchaste eso? Te lo dije. ¿Quién te crees que soy? Por ahora subelo por otros dos mil yenes……. Entonces te dejé el resto. Ya le hemos molestado bastante.]

Finalmente el chico quita su intercomunicador y le muestra su sonrisa y sus blancos y brillantes dientes.

[¡Cariño! ¡Una buena noticia! Ahora mismo tengo una villa en Kiribati, ¿qué te parece? ¿Quieres ver los amaneceres del próximo año antes que nadie? Creo que es la situación apropiada para líderes mundiales como nosotros dos……. ¿Eh? Hola camarero ¿Sabes a dónde fue la diosa?]

[Kelly-sama acaba de decir ‘Ese idiota ama las llamadas de negocios más que mi sonrisa’, y luego se fue.]

[…… Qué cosa terrible dijo. Y ella fue la que me obligó a hacer un tiempo libre para la cita de hoy.]

[Con el debido respeto, creo que la señorita Kelly lo estaba poniendo a prueba.]

[¿Me está probando?]

[Sí. Quiere ver cuánto la ama el Señor Sanada por ser egoísta.]

Así que es así. El chico estaba convencido de que podría ser eso. De todas las mujeres con las que ha salido hubo también algunas que trataron de ponerlo a prueba.

[Pensé que ella era capaz de entenderme ya que ambos estamos ocupados con el trabajo, pero parece que no…]

[Por cierto Sr.Sanada]

[¿Qué?]

[¿Todavía quieres comida para dos?]

[… Qué gracioso chiste. Ahora piérdete antes de que te suelte un Tsukkomi al estilo de Osaka.]

―― Su nombre es Sanada Masato. Él es el máximo hombre de negocios del mundo mientras todavía esta en la preparatoria.

Después de la muerte de su padre, como un demonio de previsión, en sólo unos pocos años él salvo al Grupo Sanada de la muerte y teniendo éxito en los negocios de inversiones, negocios industriales, y muchos otros negocios. Posee aproximadamente el 30% de los bienes que circulan en la tierra, el llamado “Emperador de la Economía”.[4]

――El sexto, un chico político que tenía un arma apuntada a él tan pronto como bajo del coche――

[Por el amor y la compasión de Japón!]

Un sonido húmedo se escucho en la carretera principal inmediatamente después de eso. Sangre y fluidos corporales se derramaron en el asfalto. Sin embargo, eran del hombre que apuntó con el arma al chico, no del chico. El que repelió al agresor fue un hombre alto al lado del chico. Él devolvió la pistola a su funda, y comenzó a instruir a su personal.

[El público están mirando. Por favor, limpia esto lo más rápido posible.]

[Sí, sí señor.]

[Gracias por la rápida respuesta, Secretario Jefe Chan.]

El chico alabó al hombre alto mientras los congestionados espectadores gritaban.

[Es gracias al Primer Ministro que rápidamente se movió detrás de mí que pude tener una oportunidad para disparar.]

[Es el deber de un superior dar recompensas a sus subordinados.]

[Tanta humildad. A pesar de que usted mismo podría lidiar con un agresor de este nivel, Primer Ministro……. Acaba de dejar que lo hiciera.]

Me pregunto sobre eso.

El chico que era llamado Primer Ministro entró en el edificio con el hombre alto donde el coche se detuvo.

[Esa persona probablemente está afiliada al grupo de la fraternidad.]

[Calculo. Es probable que estuvieran protestando por el aumento del presupuesto a la Defensa Nacional. Ellos creen que los militares deben ser desmantelados inmediatamente en nombre de la paz, pero lamentablemente eso va en contra de mi visión. Este tipo de cosas comenzó a ocurrir con mayor frecuencia cuando se inauguró hace dos años.]

[Qué tontos. Ni siquiera son conscientes de que fueron utilizados para hacer algo malo.]

[Su idea de abandonar el poder militar para la paz no es del todo errónea. Si se aplicara, no sólo en Japón, sino en todos los países del mundo, lo haría. Pero sólo lo exigían en Japón. Así que no puedo aceptar su entusiasmo……. Somos responsables de la vida de nuestros ciudadanos. Si no podemos defenderlos durante las emergencias, no tendría sentido.]

[No podría estar mas de acuerdo.]

[Sólo quiero decirles que el precio para la paz diaria es ahora mucho más alto de lo que pensaban. Incluso la eterna paz que quieren, al menos, no es algo que se pueda comprar al quitarme la vida con una bala.]

Al decir eso, el chico miró una vez más a la entrada con sus estrechados ojos heterocromáticos.[5] Había una profunda lástima en ellos.

En ese momento, sonó el teléfono privado del chico. Lo tomo y miró quien le llamaba…… El nombre de uno de sus pocos amigos que pueden llamarlo fue exhibido.

[Hola, ¿qué pasa Shinobu?]

――Su nombre es Mikogami Tsukasa. Él es un genio que sirve como Primer Ministro mientras que todavía esta en la preparatoria.

Tras la modificación de la Ley Electoral de las Oficinas Públicas, fue elegido como Primer Ministro con una abrumadora tasa de apoyo del 92% en las primeras elecciones públicas para el Primer Ministro japonés. Durante la Gran Depresión sin precedentes, reconstruyó el bienestar, la seguridad y la economía de Japón, que fue exacerbado por la administración corrupta del gobierno anterior, en sólo dos años. Pero también se ganó el odio junto con sus muchos logros, y ahora que es la persona más atacada en el mundo por asesinos.

――Por último, la séptima, una chica que llevaba un brazalete de ‘Prensa’ en la parte superior del Tokyo Skytree[6]――

La chica miró hacia abajo a la escena del ataque antes de llegar a la cima del Skytree con su visión sobrehumana, y comenzó a hablar en su smartphone.

[Nada… ya que te acaban de atacar me preguntaba si estabas bien.]

[El viento es fuerte……. ¿Estás escalando imprudentemente una torre otra vez?]

[Puedo ver todo Tokio desde aquí. Es conveniente para buscar una historia.[7] Como ahora.]

[Estás desesperada……. Bueno, estoy ileso debido a mi excelente secretario. Tu plan no se vio interrumpido[8].]

[Nyahaha, estoy contenta de escuchar eso. Eso es todo lo que quería decir.]

[Eres tan despreocupada como siempre…….. Tengo una reunión ahora así que voy a colgar.]

[Sí. Nos vemos en unos días en el aeropuerto de Narita. No lo olvides ¿bien?]

[Anotado]

Después de eso, terminó la llamada con Tsukasa. La chica se levantó y saltó desde los 634 metros de la torre como si estuviera saltando a una piscina.

[Nin nin ?  Esta será la primera reunión después de la secundaria después de todo. No puedo esperar――? .]

Pero la chica nunca cayó al suelo. Ella extendió el chal[9] alrededor de su cuello como un paracaídas, atrapó el viento y voló en el cielo.

――Su nombre es Sarutobi Shinobu. Ella era la descendiente del ninja Sarutobi Sasuke como su antepasado, y es la mejor periodista de preparatoria. No sólo en Japón sino también en el mundo. Desde la política y negocios a los chismes del vecindario, ningún escándalo ni crimen brutal puede escapar de su vigilancia.

――A estos 7 chicos y chicas cuyo nivel esta más allá de la escuela preparatoria, las personas los llamó “Super Estudiantes de Preparatoria” con respeto y asombro por sus excepcionales habilidades.

Pero un día, – El avión donde ellos siete viajaban, desapareció sobre el Océano Pacífico.

Incluso la desesperada operación SAR[10] no trajo ningún resultado, y ninguno de los restos del avión fueron encontrados. ¿El avión…… desapareció profundamente en el fondo del mar?

No, no lo hizo.

En este momento, el inicio de una historia ya ha comenzado. En un lugar lejano, lejos del fondo del Océano Pacífico.――

Notas

1.Una vieja expresión samurai. Significa “El derecho del Samurai a matar a cualquiera de una clase baja que insultó su honor”, o como dijo wiki, “autorización para cortar e irse”
2.Organización no gubernamental
3.Para los que no saben que es eso, son aperitivos (El gringo lo dejo así en francés así que seguí su ejemplo)
4.財界の魔王. Rey maligno del mundo financiero
5.Ya saben de diferente color y dejo la nota que puso el gringo: El Autor escribe Heterocromía con 氷 炎魔 眼, o “Ice Flame Demon Eyes” (“Ojos del Demonio de la Llama del Hielo” o algo así xD)…… ¿Qué pasa con ese nombre chuunibyou?
6.Tokyo Skytree
7.Aquí decía ‘It’s convenient for searching a scoop’ pero me fallo la traducción así que la cambie un poco xD mejor traducción en comentarios
8.Your plan wouldn’t have been interrupted mejor traducción en comentarios.
9.Aqui para que se den una idea aunque hay varios tipos el que trae es una pañoleta
10.Search and rescue

Death march kara hajimaru isekai kyusoukyoku Capitulo 14-3

En la Ciudad Laberinto (2)
Satou está aquí. “Incidentes y complots
son enlazados”, así dice el protagonista con inteligencia paralela de una
historia. Solo leerlo es bueno y todo, pero cuando actualmente son enrollado en
una, iré y romperé las cadenas de tal acto.


Un nuevo señor demonio huh.
Escribo la información que escuche
antes, “El papa del Sagrado Reino Parion, Zazaris, es un señor demonio”, dentro
del panel de notas.
“Vizconde-sama, ¿tal vez continúe la plática?”
La informante femenina tímidamente
interrumpe cuando estaba pensando mientras miraba las notas.
Es bastante raro de esto para mi persona
confirmar primero.
“–¿continua?”
“Si, el asunto en la parte oeste del
continente ha terminado con la charla de antes, pero tengo dos informaciones
más.”
¿Huh? ¿No era esta persona solo a cargo
con la información de la parte oeste del continente?
Pensando así, le urjo a ella continuar.
“Primero, hay unos buenos ojos que
vieron demonios en el laberinto de un pequeño reino localizado en la zona baja
del Imperio Saga, el Reino Yowok. El gremio de exploradores de ese reino parece
tener escuadrones cortando la fuente de información, así que la historia no ha
llegado al rey y sus naciones vecinas.”
–Oy.
Porque sabes información que el rey de
este reino no sabe.
Parece que ella supone mi pensamiento,
la informante fémina sonríe y ríe, entonces ella continua la charla.
“Eso es porque Retel-sama es buena en
usar su dinero.”
Ya veo, alguien que la Marquesa Retel
Ashinen ha enviado o traído del sitio probablemente vio al demonio en persona.
“Como Vizconde-sama tal vez sabe, hay
una alta posibilidad que un señor demonio sea el maestro de piso en un
laberinto donde demonios estén infestando. Prontamente imploro a Vizconde-sama
no acercarse al Reino Yowok.”
Siento que hay algún sutil acento en sus
palabras.
Parece que ella de alguna forma supone
que Nanashi y yo estamos relacionados.
“Si, por supuesto.”
“Vizconde-sama en verdad no lo muestra
en su rostro~”
Es todo gracias a Poker Face-sensei.
“Y, lo otro. Esta vez es un rumor desde
la zona entre el Imperio Comadreja en la parte este del continente y el Reino
Shiga.”
Fumu, esta vez es la parte este huh.
Los ojos y oídos de la Marquesa son
demasiado amplios.
Su linaje noble no es solo para mostrar.
“¿Han comenzado las comadrejas algo de
nuevo?”
“No, ellas no hicieron nada en la escala
como cuando comenzado a usar golems tipo montura para la guerra como hace 10
años.”
Una inesperada información salio.
¿Me pregunto si es como tanques golem o
caballos golem?
¿No me digas que es un tipo de golem
estilo mecha?
Tal vez vaya a ver al menos una vez.
Escribir el plan con texto rojo en el
plan para visitar el mundo.
“¿Sabes que el Imperio Comadreja
destruyo el reino de los pariente tigre y pariente lagarto y aumento su
territorio?”
“Si, lo se.”
“Los sobrevivientes de aquellos reinos
no solo se han asentado en pequeños reinos en esa zona, sino que también
comenzaron a ocupar los pueblos y ciudades del reino.”
Acaso tomaron de vuelta los edificios
que les quitaron o hicieron por invadirlos, ¿me pregunto cual fue?
Ire ahí primero como el destino de
turismo después de detenerme en la Capital del Ducado, pero creo que terminara
si ir ahí significa ver cabezas de cuerpos.
“De lejos esto no es algo inusual
incluso exceptuando laTemporada del Señor Demonio, pero invasores en uno de
aquellos pueblos masacraron a los sacerdotes que rechazaron sanarlos.”
Masacrar sacerdotes en un mundo donde
los dioses existen, gente ingenua existe en verdad.
“Esto también paso en un territorio
ocupado, pero la siguiente día, la gran mayoría de aquellos invasores fueron
convertidos en pilares de sal.”
Pilares de Sal huh… Eso es un castigo
divino que aparece en las escrituras en mi viejo mundo.
“Un guapo hombre en ropas blancas
apareció ante los pueblerinos que fueron aterrorizados viendo aquellos pilares
de sal y dijo,『Este es un castigo divino』. La gente del pueblo pregunto -quien era el hombre, y–”
La informante pausa ahí y ve mi reacción.
Cuando le envió una mirada para urgirle
a continuar, la informante femenina encoge sus hombros sin interés y continua
la historia.
“–Él se presentó a sí mismo como un
apóstol del Dios Zaikuon.”
Apóstol de Dios huh…
Escuche el nombre varias veces antes
pero el real [Apóstol de Dios] o quizás un impostor del [Apóstol de Dios]
finalmente apareció.
“Pero bueno, es todo caso, él
probablemente es un impostor supongo…”
La informante deja salir un suspiro y
sacude su cabeza.
“¿Acaso tienes alguna base para eso?”
“Si, sería una historia diferente si
fueran de los otros dioses, pero alguien que se llama a sí mismo como el
apóstol del Dios Zaikuon es definitivamente un impostor.”
La informante para de hablar como si eso
fuera ya conocido como una explicación.
“Lo siento, pero no soy demasiado
informado de charlas religiosas. ¿Podrías decirme la razón?”
“No es sobre religión, sino la situación
de los dioses. Hace 30 años, el dios Zaikoun hizo al Dios Dragón enojar y fue
asesinado. De hecho, los sacerdotes del templo Zaikoun no pueden usar magia
sagrada, así que el Dios Zaikoun no debería haber revivido aún.”
Ya veo, así que la fuente de la magia
sagrada es el dios en sí huh.
Por cierto ellos saben sobre [Hizo al
Dios Dragón enojar] parte por preguntar a la miko del oráculo de otros templos
por preguntarle a los dioses al respecto.
Parece que los dioses aquí pueden
fácilmente revivir incluso si ellos mueren.
Finalmente entiendo como Aze-san pudo
fácilmente decir, “No hay problema si tu solo asesinas al Dios Dragón”, cuando
confesé sobre eso a ella.
Tomando su longevidad en consideración,
es probablemente como, “El dios está durmiendo después de atrapar un
resfriado.”
“Si ese tipo es un impostor, ¿Cómo el
vuelve a los invasores en pilares de sal?”
No hay tal hechizo en mi repertorio al
menos.
“Tal vez sea un hechizo prohibido de
esto, pero siempre y cuando él sea del mismo nivel como las 33 Varas Shiga, hay
muchas otras maneras de fácilmente hacerlo.”
Urjo a la informante que declara así a
continuar.
“Es posible hacer pilares de sal que
parezcan exactamente como gente real con magia de tierra para controlar la sal.
Entonces solo necesita sepultar a los invasores profundamente y el castigo
divino es completado.”
Su razonamiento es ligeramente forzado,
pero ciertamente posible.
Estoy ligeramente molesto con el hombre
a llamarse a sí mismo [Apóstol de Dios], pero él solo da venganza a los
sacerdotes asesinados de todas maneras, así que dejarle solo no debería causar
problemas.
No sé si la suposición de la información
de ella es correcta o no, pero incluso si él es la cosa real, siempre y cuando
no intente sabotear mi viaje turístico o haca la [Supresión de Civilización],
no tengo la intención de hacer algo contra él.
Si se encarga de los demonios y señores
demonios por sí mismo, entonces eso solo significa la disminución del daño al
mundo y mi trabajo.
Dejando de lado al apóstol falso,
probablemente debería investigar al demonio en el laberinto del Reino Yowok y
las sospechas del papa siendo un señor demonio.
Una vez mis negocios en la ciudad
laberinto estén terminados, debería revisar fuera mientras también hago mis
movimientos.
Una vez el banquete de la Marquesa
termina, sigilosamente visito la casa de un viejo conocido mio que he hecho una
promesa con él.
“Ahora bien, ¿qué tipo de asuntos lo
traen usted para visitarnos tan tarde en la noche? Tú has pedido por la
presencia de mi esposa de antemano así que puedo suponer a cuestas, pero me
gustaría escucharlo claramente desde tu boca.”
Irritado con mi visita a altas horas de
la noche, el Barón Dyukeli dice así.
Su esposa está sentada al lado suyo como
solicite, pero no sé porque Ms. Merian que está en vestido está entre la
pareja.
Bueno, esto es un problema familiar de
todas maneras, no hay necesidad para enviarla fuera.
“Entonces, iré al punto.”
Cuando digo así, Merian traga saliva.
Es ligeramente inmodesto, pero no es una
etiqueta suficiente para mí apuntarla mal.
Saco una caja de madera desde la bolsa
mágica al lado mío y presento al Barón Dyukeli.
“Por favor acepte esto. No olvide
apreciarlo antes de usarlo.”
“¿Esto es? ¿Es este un regalo de compromiso?”
–¿Ha?
El Barón Dyukeli pregunta mientras abre
la caja de madera.
Extraño… Debí haber escrito a ellos una
carta sobre el panacea de antemano…
¿Quizás la loli maid a quien pedi
entregar la carta ha fallado?
No, dudar de la gente no es una cosa
bueno de hacer.
“¡Cariño! ¡Es-esto es!”
La esposa del barón apunta su dedo a la
botella de panacea dentro de la caja de madera con una voz afable.
Para ser exacto, ella apunta a la nota
escrita en la botella en Lenguaje Shiga como [Panacea].
Es la medicina para recuperar la
Enfermedad Goblin del hijo mayor del barón.
“¡¿Panacea?! ¿Cómo fue que conseguiste
una cosa tan valiosa?”
“Lo conseguí de un mercante regular.”
Actualmente la hice yo mismo. Le
pregunte a la bien informada Yuika de primera generación a enseñarme la receta,
pero fue una simple receta donde solo necesitar diluir elixir con poción mágica
de bajo grado por unas cien veces.
Normalmente es imposible de conseguir a
mano el Elixir, así que solo aparece como un drop raro en laberintos.
“¡Sir Pendragon! ¿Po-podría ser adecuado
para darme este panacea?”
Como esperaba, es demasiado brutal de mí
si estoy aquí solo mostrándolo.
“Si, por supuesto. Por favor úselo para
tratar a su hijo.”
“Gracias Sir Pendragon. Le compensare
esto incluso si toma docenas de años.”
El Barón Dyukeli me abraza sobre el
escritorio con sus huesudos brazos.
Estoy agradecido que le complazca.
Sin embargo, docenas de años es mucho.
Dejando eso de lado, no tengo intención
de pedir por dinero por un objeto que prepare por mi propio deseo.
“No, no es necesario pagar por esto.”
“¡Entonces, es en verdad un regalo de
compromiso! Entonces, mi hija–”
“–No, mi prometida es suficiente con
solo su alteza princesa.”
Fue un poco grosero pero rápidamente
interrumpí al Baron Dyukeli.
Usando a la princesa como una excusa es
demasiado todo poderoso.
Usarla demasiado en verdad me forzara a
casarme con ella supongo, así que tengo que se prudente con esto.
“Es eso así–. Sin Pendragon ha sido
intimo con mi hija, así que lo malentendí.”
El humor se siente un poco como un
funeral.
¿Acaso él en verdad quería a su hija
casada con un vizconde tanto?
[Kiel: Niveles de denso aumentando… ya
paso el nivel de dios…]
Parece que Merian quería ser un
explorador, así que creo que no debería descuidadamente ofrecerla en un
matrimonio, pero ella parece rechazada como su padre.
Quizás su orgullo como doncella fue
herido debido al rechazo.
[Kiel: Y en aumento…]
Como una disculpa, le doy a ella la
armadura de cuero mark 1 que es del mismo tipo como Zena-san.
Esa armadura es fashionista, y un equipo
especializado en defensa a pesar de su aspecto normal como armadura de cuero,
así que no debería preocuparse de ser herida que podría prevenir que se casara.
De paso, el Barón Dyukeli insistió en
compensar por el panacea no importa qué, así que decidí que me prestara sus
conexiones personales por un poco.
Es sobre la conexión con los mercantes
de la ciudad laberinto no los nobles.
Entre ellos, les pido a presentarme a
los mercantes ya retirados que gustan de niños. Estoy pensando de regularmente
sostener un evento para ellos jugar y enseñar a los niños la manera de hacer
bloques constructores y canastas o los gustos en la distribución de comida en
la plaza.
Una vez los niños se vuelvan un poco
habilidosos, probablemente no esperen por la distribución de comida con hambre
en sus estómagos nunca más y tendrán una alternativa de ir dentro del peligroso
laberinto.
A la mañana siguiente, una invitación
para celebrar la recuperación del hijo del Barón Dyukeli vino.
Desafortunadamente, será en cinco días,
no estaré presente en la Ciudad Laberinto así que no seré capaz de participar.
Dejando eso de lado, parece que hay un
montón de niños nobles que sufren por la enfermedad goblin, tengo a la Firma
Echigoya vendiendo la medicina por una gran suma de dinero.
No hay necesidad de vacilar con gente
que no son conocidos y tienen un montón de dinero.
Después de escribir una carta de
celebración al Barón Dyukeli, voy a saludar a los compañeros promesas mientras
los traigo junto con los oficiales civiles del Condado Seryuu y personal
militar.
He hecho el arreglo necesario de ante
mano, así que el contrato fue completado sin problema.
Le di equipamiento que son la misma
clase al de Merian a las tres personas del Escuadrón Zena.
Zena-san debería ahora descansar bien
con esto.
Cuando voy de regreso a la mansión,
varias maids y niños de orfanato estaban mirando a el barco volador sin
cansarse.
“¿Acaso quieren ir dentro?”
“¡Vizconde-sama!”
“¡Quiero subir!”
“¡Ir dentro!”
Voy a partir esta tarde, así que la
gente corre a esa sugerencia.
“Es un barco.”
“¿Nos caeremos?”
“Está bien.”
“Alinear~”
“Alinéense propiamente nodesu.”
“Jóvenes organismos, sigan después de mi
así comando.”
Tama y Pochi hacen a los niños
alinearse, y entonces Nana los guía al barco volador.
El barco volador tiene [Red de Fuerza]
para prevenir a la gente caerse, así que no hay problema incluso si los niños
se cae desde la cima de la cubierta.
“Amo, los niños en la lista se han
reunido en la sala de estar.”
“Ah, gracias. ¿Les has explicado a
ellos?”
“¡Pero por supuesto!”
Dirigiéndome junto a Arisa que responde
confiablemente, camino hacia la sala de estar.
Los niños dentro de la sala están
envueltos en tensión no diferentes a estudiantes cazando trabajo.
“Deben relajarse. Creo que ya lo
escucharon de Arisa, estoy pensando en dejarlos estudiar en la escuela infantil
de la academia real si ustedes desean. Por supuesto, la Casa Pendragon les
proveerá la institución y los gastos de vivienda durante su estadía. Después de
completar la escuela infantil, voy a preguntarles si quieren continuar a la
escuela superior y tener buenos resultados para asistir y volverse el modelo
para los niños futuros.”
En este lugar, están los tres niños que
han exitosamente aprendido magia bajo la guía de Arisa y Mia, y nueve niños que
han aprendido a leer y a hacer aritmética básica de entre los niños huérfanos y
las maids.
Como recompensa por completar todo eso
en solo varios meses, les sugerí a ellos ir a estudiar a la Academia Real.
“¡Vizconde-sama! ¡Quiero ser un mago
como Arisa y Mia-sama! Cuál es el método más corto, ¿ir a la escuela de la Capital
Real o trabajar duro en el laberinto con los hermanos Pendora?”
El chico que usa magia para voltear
faldas pregunta sin ser afectado por la tensión en el lugar.
“Si quieres pulir tus habilidades en
magia en una corta cantidad de tiempo, lo más rápido es ir dentro del
laberinto. Sin embargo, si quieres ser un mago que esta al mismo nivel como
Arisa y Mia, creo que lo mejor es si propiamente estudias las bases en la
Academia Real antes de ir dentro del laberinto.”
Si él quiere ser un mago que solo puede
usar magia de ataque como un juego, entonces debería solo elevar su nivel en el
laberinto, pero si quiere usar magia que es útil fuera de batallas, es mejor
para él estudiar la estructura mágica y la manera de leer los hechizos.
“¡Okay! ¡Iré a la Academia Real!”
“Iré yo también.”
“¡Yo también!”
Una vez el chico que levantaba faldas
poderosamente declaro, los otros niños también expresan sus deseos uno después
de otro.
Ellos van a ir a la Capital Real por
montar una carreta en medio mes. El enrolamiento de la escuela infantil fue
durante el año nuevo, pero es posible aceptar nuevos estudiantes para primeros
años si ellos muestran resultados sobre un cierto nivel.
Además, creo que la decano amante de los
elfos de alguna forma ayudara si traen una carta de recomendación escrita por
Mia.
Después de enviar a los niños a casa,
llamo a Ms. Miteruna y tres maids entre las loli maids.
“Amo, ha usted llamado por mi–”
“Esto será un poco largo, así que por
favor toma asiento.”
Ofrecí un asiento a Ms. Miteruna.
Tuve éxito en obligar a Ms. Miteruna que
firmemente se negaba a tomar asiento después de decir, “Mi cuello dolerá si
continuo hablando como esto.”
Le dijo que quiero despachar varias
maids a la mansión de la Capital Real para aprender técnicas de maid más
sofisticadas.
“Por supuesto, no quiero que
malentiendas que tengo problemas con las enseñanzas de Miteruna. Enseñar a los
niños que no saben nada para volverse maids en tan corta cantidad de tiempo es
bastante el logro.”
Sigo con eso ya que el rostro de Ms.
Miteruna se consterno.
De hecho, debería haber sido imposible
elevar a ellos a este nivel con solo la motivación de las loli maids.
Sin embargo, inesperadamente me volví un
noble superior, así que me gustaría que mis empleados pulan sus técnicas incluso
más.
“Entiendo lo que el Amo esta diciendo.
Pienso que estas tres deberían ser capaces de resistir el entrenamiento en la
Capital Real.”
“”“¡¡¡Jefa-maid!!!”””
Las loli maid están mirando a Ms.
Miteruna con ojos llorosos.
“Miteruna, ¿no quieres ir a la Capital
Real?”
“Si, si el Amo lo permite, me gustaría
tomar el rol de elevar los niños que serán enviados a la Capital Real así.”
Ya veo, no improvisar su propia
habilidad, sino volverse su educadora huh.
Ella es un talento bastante raro.
Incrementare su salario para su rol de
entrenamiento.
“Estoy contando contigo, Miteruna.”
“Si, dare lo mejor para estar a la
expectativa del Amo.”
–Moderadamente okay.
Entonces, después de haber completado
los negocios en la Ciudad Laberinto, partimos a la Capital del Ducado donde el
concurso de cocina va a ser llevado.
Bajo el pretexto de animar a Lulu, el
grupo de Ciudad Laberinto están llendo a la Capital del Ducado, y regresaran a
la Ciudad Laberinto a través de la ruta terrestre una vez el concurso de cocina
termine.
De hecho, ellas van dentro y fuera del
laberinto a través del Palacio en la Isla como la base, y entonces las envié a
la vecindad de la Ciudad Laberinto después de que suficiente tiempo ha pasado
para que el viaje a tierra pase.
“¿Amo no participara en el concurso de
cocina?”
“He sido elegido como un juez especial
ya vez.”
Aparentemente, es nombrada [Copa
Pendragon].
Incluso [Copa Chef Milagroso] podría
haber sido mejor que eso.
“¡Entonces no hay necesidad de
retenerse! ¡Pensare en un platillo que silenciosamente tomara el corazón del
Amo!”
“¡E-espera Arisa! ¡No me jales tan
fuerte!”
“Saborear~?”
“¡Pochi ayudara con saborear también
nodesu!”
Siguiendo tras de Arisa y Lulu, Tama y
Pochi también se dirigen a la cocina exclusiva de Lulu.
“Amo, todos han completado sus
preparaciones.”
“Master, quiero una armadura escarlata
también, así pido.”
Liza y Nana aparecen desde la sala de
estar habiéndose armado a si mismas.
Después de las dos, Sera, Zena-san, Lady
Karina y la princesa; bellezas envueltas en armadura escarlata hecha de
Hihiirokane se muestran.
Esta armadura tiene la funcionalidad
auto-ajuste, así que no hice alguna medida atractiva de tamaño.
“Satou-san, gracias por esperar.”
“¿E-está bien para mi vestir esta
espléndida armadura?”
“La presión en mi pecho es sofocante
desuwa.”
“Es como el caballero que aparece en
cuentos.”
Después de elogiar a las cuatro damas,
“Se ven en verdad bien en ustedes”, las envió al sitio planeado.
Es el lugar para subir nivel cuando
eleve a los niveles de las Ejecutivas de la Firma Echigoya a nivel 30.
“He conectado esto a la puerta
permanente, así que dejen descansarlas en el palacio cuando ellas caigan por la
intoxicación por subir nivel.”
“Entendido.”
“Si, Master.”
Después de darle instrucciones a Liza y
Nana, tapo mis oídos por escuchar los gritos detrás, comenzando la preparación
para salir.
Justo ahora, Mia debería estar
disfrutando por si misma tocando con el órgano de pipas más grande del mundo en
la sala de conciertos al lado del palacio.
Darles a los niños instrumentos
musicales para nutrir su sensibilidad acústica tal vez sea una buena idea.
Elijo la magia [Equipo: Kuro] en la
Columna de Magia y transformar a Kuro.
Usando esta magia original, no solo
equipa las ropas y mascara, sino también automáticamente coloca todo tipo de
información como mi nombre, ocupación, y los otros en la columna de Intercambio.
Es una magia bastante adecuada para una
persona despreocupada como yo.
¡Ahora que he terminado el cambio, vamos
a revisar los lugares de los señores demonios!
◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇

Okaa-san Capitulo 2 (Parte 1)

Capitulo 2: Es solo una coincidencia que sean solo chicas.
No me malinterpreten. No me miren con esa sonrisa.
El tutorial fue terminado. Fue
finalmente momento para comenzar la aventura.
Masato y Mamako se movieron fuera del
palacio de transportación, cruzando el ultimo puente desde la isla flotante, y
llegaron a una isla que era el punto final y también el punto de partida.
Y entonces, los dos que estaban de pie
en el Círculo Mágico trazado en el piso esperaron por ese momento.
“Debería estar bien esperar por la
transportación aquí, ¿correcto?”
“Si, eso es cierto. Esta también escrito
en el libro guía… Ah, pero… parece que tomara algo de tiempo para la
confirmación de seguridad, así que por favor lean los asuntos básicos mientras
esperan. Esta también escrito para hacerlo junto con mi niño. Aquí, mira.” Ella
presiono de cercas.
“Y-ya lo sé. Más bien, estas acercándote
demasiado. Es demasiado ya.”
Empujando el hombro de Mamako que estaba
presionando en él, se deslizo a través de los contenidos del libro guía.
El juego online a donde Masato y los
otros fueron transportados era [MMMMMORPG(temporal)].
Este juego parecía usar el servidor
principal que la Oficina Gabinete estaba a cargo como el punto de inicio, al
conectar con los servidores locales individuales de cada una de las cuarenta y
siente prefecturas a cargo, ellos diseñaron y programaron un mundo
multi-variable.
Solo eso, era la versión beta ahora,
ellos estaban en la mitad de recolectar datos desde los jugadores de prueba,
así que solo el servidor de Tokyo fue utilizado.

“Oi oi, esos son varios mackerels[1]
o más bien ya son suficientes… Esto no es a una escala a medias…”
“¿Mackerels? … Saba… saba… Hey Maa-kun,
¿Dónde está escrito este mackerel? Mama no lo encuentra.”
“Ahh, mackerel es, en otras palabras,
servidor.”
“¿Oh es eso así? Así que el servido es
de hecho mackerel… mackerel es asombroso después de todo. Es bueno para tú
salud, e incluso sale en juegos.”
“No, eso no es lo que quiero decir… haa,
bien lo que sea… No habrá final si explico cada cosa pequeña.”
Más que eso, la prioridad era revisar el
fuera de línea. Continuando con afirmar el libro guía.
El servidor de Tokyo que era actualmente
usado había construido este mundo en un tema común de fantasía. El entorno fue
hecho usando el escenario Europeo. Parece haber usado los escenarios de bahías
Mediterráneas que aún había en varios vistazos de Edad Media restantes para
fundar la forma del terreno.
En una nota de lado, parece que el
tiempo fluía en el mundo y el mundo del juego como el mismo. Masato y su madre
fueron transportados en la tarde así que… ah.
“Oh, finalmente huh.”
El Círculo Mágico bajo sus pies
repentinamente libero luz destellante, envolviendo a Masato y su madre. Ellos
desaparecieron junto con la luz.
En el ocaso del atardecer, placentera
brisa marina fluia. Un pueblo con calles labradas con piedras y murallas
blancas se mostraron ante sus ojos.
Viendo eso, las primeras palabras de
Mamako fueron.
“¡Oh mira! ¡Parece como costa!”
“Costas, dices… incluso si le digo a mi
mama sobre cosas como fantasía o paisajes de otro mundo, no podría entenderlo,
no puedo evitar que estés sorprendida… bien entonces, por el momento, vamos a
ir.”
El primer punto de partida del mundo era
[Reino Kassan].
Moviéndose desde el punto de
teletransporte con un Círculo Mágico trazado, pasando a través de la puerta
robusta, ellos llegaron a la capital del Reino Kassan. La capital se desplegaba
con el castillo real blanco como el centro.
Los edificios hechos de arcilla blanca
de pared y ladrillos daban una sensación de seguridad y un profundo sabor de la
tierra a quien mirara. El sonido viniendo de carruajes de caballos pasando por
traer humor de vuelta. Si alguien viviera en aquellas casas una vez, ellos tal
vez sienten que aventurarse podría ser demasiado problemático. Tal escaparate
continuaba…
“¿¡Ha!? ¡Hay varias tiendas en ese lado
de la calle! ¡Vamos a ir y darle una mirada! *¡Dash!”
“No no, deberíamos ir alrededor del
pueblo una vez para notar la geografía… Uh, ¿¡ella ya corrió!? ¿¡Es esta la
velocidad de mama, no, especialidad de un personaje femenino!?”
Mamako aprendió la habilidad de búsqueda
de compras a alta velocidad 【Alma de Comprador en Ventana】.
No, fue una broma. No había tal
habilidad.
Si tú cambias a una calle diferente, ese
lugar era una encrucijada para calma y reclamos. Al momento que ellos pusieron
un pie dentro, fuertes gritos vinieron de los tenderos promocionando sus
tiendas para atraer clientes.
“¡Espere, jovencita de ahí! De seguro
usted viste algunas ropas extrañas. ¿Es usted una viajera de un mundo
extranjero? Entonces échele una mirada a los productos de mi tienda. ¡Me
asegurare de ser baratos para una linda jovencita como usted!”
“Oh cielos, llamarme jovencita. Aunque
yo ya tengo tal gran hijo.”
“Está bien no decir algo como esto cada
vez. Geez… ah, hola.”
“¿Eh? ¿Es ese tu hijo?… ¿Es usted una
dama con su hijo?”
“Ah, pero ahora somos compañeros madre e
hijo. Haberme vuelto compañera de mi hijo. ¿No es eso encantador?”
“¿Compañeros madre e hijo? … Err…?”
“¡Tu no hables como ser compañeros o lo
que quieras! ¡Eso hará al tendero congelarse! ¡Okay, muévete! ¡Comienza a
caminar!”
“O-K.”
Masato cargo el equipaje en sus hombros
para pagar un poco su culpa, y empujo a Mamako, que estaba saludando de vuelta
a cada una de las personas que encontraban, en su espalda.
Los dos se veian como un par de madre e
hijo viajando de paseo en un mercado sobre el mar al aire libre, pero ellos
entendían que no era simplemente un punto de turismo.
“Este lugar es en verdad dentro de un
RPG de fantasía…”
Con solo una mirada, había tiendas
vendiendo espadas y lanzas, tiendas vendiendo escudos y armaduras, y gente que
se ven como guerreros con aquellos equipos caminando derechos pasan frente a
sus ojos. La sensación de aquellas túnicas cortas de chicas que tienen un aire
de magos fluye ligeramente como pasan al lado.
Es
en verdad fantasía… así de increíble… estoy dentro de un juego…
Sintiendo la credibilidad de esto solo
ahora, Masato sin intención se emocionó.
Mamako se acercó para observar a su hijo
y darle, a quien estaba mostrando esa apariencia, una mirada de lado.
“Hey Maa-kun. Deja de sonreír mientras
fisgoneas las caderas de aquellas chicas. Eso te hara ver como un pervertido,
¿sabes?”
“¡Estas mal! ¡No estoy mirando ese tipo
de cosas!”
“Ufufu. Solo bromeaba. Mama propiamente
entiende lo que Maa-kun está pensando sobre esto justo ahora. Somos mama e hijo
ya vez, podemos leer la mente del otro.”
“¿Hou? Entonces intenta hacer una
suposición.”
“Cierto no, Maa-kun… ¡te sientes feliz
por estar caminando con mama! ¡Heheh!”
Mamako declaro confiadamente con su
sonrisa en completa felicidad.
Masato pudo solo gruñir. Qué es lo que esta persona está diciendo. No
tengo idea.
“Nai waa. Sentirme feliz por estar
caminando con mama es la razón más imposible. Esta madre totalmente no tiene
idea sobre los sentimientos de un adolecente. Ah geez, totalmente fallaste.
Fallaste como una madre.”
“Tú sabes, por las palabras que mama ha
escuchado hasta ahora, aquellas son las segundas más dolorosas. *sob sob*”
“¡Po-por favor para de decir esa línea!
¡Mi elección de palabras fue pobre! ¡Me disculpo!”
Él hizo una disculpa inclinándose a
noventa grados. Manteniendo esa pose de disculpa, él reviso la condición de su
madre.
Mamako estaba sonriendo felizmente. Su rostro,
que era incluso juvenil debería tener un límite, mostraba una sonrisa pícara.
“Ufufu, eso es en verdad efectivo.
Entonces mama convertirá aquellas palabras en Magia de Mama.”
“magia que debilita el estado mental del
héroe-hijo… Que maliciosa…”
Parece que Masato, que había justo
recuperado de su impacto de antes, tomo un poco más de tiempo para recuperarse
ahora. Eso de lado.
“Hmm, ¿es así? Vamos a caminar por el
momento, pero deberíamos ir a un lugar después…”
“Ufufu. Déjaselo a mama. Mama propiamente
te guiara después de todo.”
“Guiarme dices… mama no sabes nada sobre
este tipo de juegos, ¿correcto?”
“Eso es verdad, pero está bien. Porque
mama tiene esto.”
Mamako orgullosamente mostro el libro
guía. Ya veo. Está orgullosa que tiene
eso.
“No podemos ser negligentes en la
preparación para nuestra aventura. Así que primero de todo…”
“Reunir acompañantes. Supongo.
¿Correcto?”
“Si, eso es correcto. El libro guía
también sugiere reunir compañeros primero. Ese siendo el caso… Muy bien, es
aquí. Este camino.”
La guía de Mamako presento un edificio
que era firmemente construido en la esquina del distrito comercial a él.
A primera vista, parece ser una tienda
de café con una terraza, pero viendo a la gente viniendo y saliendo de tener
cuerpo robusto mientras carga equipos y armaduras protectoras, ellos entienden
bien que este no era un lugar para disfrutar el té. Aventureros en el área de
la terraza disparan miradas de evaluación que no contiene piedad a este lugar,
dándoles a ellos una buena probada de un humor de agresiva bienvenida.
El cartel colgado afuera del edificio
muestra『Gremio
Aventurero』. En otras
palabras, eso significa.
“Este lugar no da una vibra de amateur o
ingenua. Puedo sentirlo… Fuu, justo lo que quería.”
“Oh bien, Maa-kun, que usualmente solo
dice ‘Aaa’ o ‘Lo que sea’. Está diciendo tales palabras geniales… Mama ha
descubierto un nuevo lado de su hijo.”
“¡Ca-cállate! ¡No evalúes los
comentarios de tu hijo!… Tan difícil…”
“Ufufu. Lo siento por eso. Ahora bien,
Maa-kun, ¿puedes pasarle a mama sus espadas?”
“¿Eh? A-aah, muy bien…?”
Él no tenía idea que es lo que ella
estaba pensando. Él solo paso la Espada Sagrada de la Madre Mar Altra que
estaba atascada en la bolsa tipo Boston.
“¡Eii!”
Mamako balanceo su espada hacia el
edificio del gremio. Mamako ataco “… ¿Eh?” Agua desbordo desde el destello de
la espada color azul profundo que fue balanceada “Espe…” y se volvió en gotas
de agua “¿Oii?” que fueron disparadas juntas.
*¡Zugagagagagagagagaagagagaag!* Balas de
agua a alta velocidad atacaron al gremio. Un sonido abrumador de destrucción
hizo eco continuamente, pilares y paredes llenas de agujeros colapsaron. Gritos
de aventureros fueron escuchados solo un momento después de la caída.
Masato, que esta paralizado por eso,
solo regreso a sus sentidos después de eso.
“… Um, mama… qué estás haciendo…?”
“Ser molestados no es bueno, así que tal
vez vaya con [¡Agallas!] Desde el comienzo. El libro guía menciona esto.”
“El significado de agallas es diferente…
o más bien, esto no es mal.”
[Kiel: Hace referencia a las ‘agallas’
que muestra uno cuando enfrenta a la típica escena cliché del matón molesto
cuando te registras o visitas un gremio por primera vez…]
La mitad del frente del edificio del
gremio ha sido medio-destruido. Sin embargo, el problema más grande fue la
seguridad de aquellos aventureros en la terraza. Si alguien se volvió víctima
del ataque de Mamako.
‘PK,
o intento de PK… ¿no recibiremos una penalidad?’
PK—o Player Killer (Asesino de Jugador).
Ellos podrían matar otros personajes. Aquellos que comentan eso podrían darles
el castigo correspondiente. Diciendo lo siento podría no resolver esto.
Masato estaba de pie ahí con rostro pálido
mientras movimientos vinieron desde el lado del edificio. Alguien cruzo los
restos de la puerta destruida y estaba caminando hacia ellos.
La otra parte parece ser una mujer. Ella
está vistiendo un uniforme como Clerk, con largo cabello negro y un rostro
calmado…
La cabeza de esa persona estaba
ligeramente sangrando.
“O viajeros en un viaje, bienvenidos al
Gremio de Aventureros. Soy la recepcionista Shirarase como informomo. Si estas
en búsqueda de compañeros de su viaje, por favor venir a este lugar.”
Esa persona llamada Shirarase con gesto calmado
y su mano guiándonos mientras su cabeza está aún sangrando.
La persona que estaba sentada en el
escritorio medio-destruido era…
“Umm, Shirase-san…”
“Creo que ya he infoformado[2]
a usted que soy la recepcionista Shirarase, ¿no es así? Si no esta satisfecha,
¿debería tomar aquellas cosas que su hijo no quiere saber de su madre para ver
más? *¿Drip?*”
“¡Esta es mi primera vez conociendo a
Shirarase-san! ¡Gusto en conocerla-ssu! ¡Chii-ssu![3]”
El nombre de la mujer en el escritorio
medio destruido era Shirarase. Ella se veía muy parecida como Shirase, o más
bien, no había duda que ella era la persona en sí, pero ella es Shirarase.
“Entonces, una vez más. Bienvenidos al
Gremio de Aventureros. *Drip.*”
“Gracias y por favor cuide de nosotros.
Así, umm… ¿esta usted bien? Ha estado sangrando desde hace rato.”
“Por favor no se preocupe sobre esto.
Esto es solo un acto… Y esta mi es un objeto, no un PC o NPC. Además no debería
haber penalidad de PK. El objeto edificio siendo posible destruir es un bug, así
que por favor ignórenlo.”
“Y-ya veo. Estoy agradecido~… Qué alivio,
mama.”
“¿Eh? S-si, eso es cierto”
“Así que esto significa que en la
batalla de objetos, el PC del NEC ganara la batalla PK, ¿algo como eso cierto?”
“Bueno, sí. Por el momento a ser, eso
está bien. Es un asunto asombroso.”
Objetos eran generalmente algo que no
actua como un personaje. PC era personaje jugador, NPC era personaje no
jugador. Él podría dar a Mamako una lección de apoyo en aquellos términos
luego.
“Entonces, sin ir más profundo, déjeme
presentar los aventureros registrados en este gremio. Aquí.”
Como Shirase dijo eso, ella tomo fuera
algunos documentos. Fue una pila de papeles tipo parche grueso. Aquellas pilas
de papeles enumerados rondaban los cientos o más.
“E-estos son demasiados…?”
“Este es solo sobre un décimo del total.
Ya que no hay límite para el número de miembros de equipo, por el bien dejar
elegir los acompañantes como gusten y reunirlos, el equipo administrativo
trabajo arduamente para hacer esto. El número está planeado a incrementar en el
futuro.”
“En verdad… erm, entonces, ¿son todos
los compañeros NPC?”
“Los jugadores de prueba son también
incluidos. Sin embargo, hay pocos de ellos, así que me pregunto si puede
considerar esto como una rareza.”
“Este desarrollo es como intentar tu
suerte en gacha, huh…”
[Kiel: Aunque ya lo explique en otra
novela… es los juegos de suerte en coleccionables…]
“El primer piso del edificio está bajo
reparación. Por favor usen el cuarto privado en el segundo piso para investigar.
Traeré más documentos luego, así que por favor tómense su tiempo”
Sobre el primer piso del gremio que
parece como el sitio después de una balacera, ellos se dirigen a un cuarto
privado en la parte de atrás del segundo piso que de alguna forma no fue
afectado.
Masato tiro los documentos en la mesa
con un sonido fuerte, y se sentó en el lado opuesto, de cara a Mamako.
Para calmar su corazón nervioso, él tomo
unos pocos suspiros profundos de la brisa fresca que fluía desde la ventana, y
comenzó la selección de acompañantes.
“Muy bien, este es mi turno. Déjamelo a
mí, al veterano MMORPG, elegiré los compañeros más adecuados. ¿Esta eso bien,
mama?”
“Por supuesto. Mama está mirando delante
a lo que mi niño Maa-kun elegirá. Encuentra una buena chica.”
“Po-porque estás diciendo que el
candidato tal vez sea una mujer…”
“¿Pero no se supone que sea así? Ya que
estaremos viviendo juntos desde ahora, es una experiencia con un montón de
cosas juntos, crecer juntos, tu estas mirando por compañeros con eso en mente,
¿cierto? Mama piensa que esto es lo mismo como elegir tu novia o compañera para
casarse.”
“Uu… eso no es exactamente mal, pero…
esto es elegir compañeros. Esto es puramente elegir compañeros. Un.”
Pero ser el tipo de rostro o cuerpo,
aquellos que podrían definitivamente reflejar las preferencias de quien elige.
De todas maneras.
Masato miro a los documentos. En el
documento, el nombre del aventurero y profesión, todos los estados, e incluso
un retrato de la persona actual fue grabada.
“El criterio principal a juzgar es la
formación de batalla, huh… tenemos dos atacantes físicos, así que… primero, un
defensor y un sanador. Un atacante mágico, y también un apoyo podría ser bueno…
ah, pero hay también profesiones de producción… Quiero al menos una persona con
producción de objetos para ser mi compañero también… vamos a tomar siete
miembros como la marca y buscar…”
Con profesión como una guía, rostro y
cuerpo como referencia, incluyendo un poco de la preferencia personal, Masato
comenzó a sacar personal potencial.
“Ooh, este parece bueno.”
Compañero candidato uno. Su nombre era
[Rushiela]. Dieciséis años. Su profesión era Caballero Pesado. Una profesión
especializada en defensa que podría tomar el ataque enemigo con una mano, pero
ella tenía una habilidad que podría convertir una porción del daño tomado en
poder de ataque, así que era posible para ella participar en ataque si lo
necesitaba.
Su retrato era también de buen aspecto.
Armadura de metal sobre su delgado cuerpo, un escudo robusto sostenido por sus
delgados dedos, una fuerza escondida dentro de un aspecto digno… Ella dio una
impresión bastante buena, pero su lado lindo tal vez salga después de romper a
través de su dura coraza, un buen talento que podría también espera de un gap
moe.
“El siguiente es… ¡ooh, elfo
encontrado!”
Compañero candidato dos. Su nombre era
[Sarite]. Diecinueve años(Conversión de edad Humana). Su profesión era
Sacerdotisa. Una experta en magia de recuperación. Capaz de purificar
no-muertos.
Túnica verde brillante envuelve su
cuerpo, un pendiente con Árbol Sagrado con cadena ajunta a su mano… Una
elegante onee-san estaba dibujada en su retrato, a pesar de ser un retrato,
mostraba una hermosa elfa con sonrisa gentil.
“Bien, bien, he reunido algunos
candidatos de alta calidad. Luego es… ¡oh, chica sucia encontrada!”
Compañero candidato tres. Su nombre era
[Torino]. Catorce años. Su profesión era Ladrón.
Ella tenía habilidades de apoyo tales
como prevención de golpes y incrementar la velocidad del equipo. Otros incluían
la habilidad de Desbloquear.
Ella vestía un top simple y pantalones
cortos. Su rango de exposición era también fuera excesivo ya que estaba
ligeramente equipada. Sin embargo, si ella se movia mientras estaba siendo
ligeramente equipada, tal vez sea capaz de atrapar la vista de su antebrazo. Él
no sabía hacia donde poder mirar.
“Muy bien, muy bien, echar una mirada es
también bueno. Ese color de piel es también grandemente bienvenida… Así que,
bueno, por ahora debería ir con esto.”
Masato alineo los tres documentos que
tomo, y reviso ellos de nuevo. La defensa, recuperación, u entonces el apoyo al
equipo Él creía que los miembros necesarios para la batalla han sido zanjados.
“Ok, lo he decidió… Mama, tomemos estas
tres personas como nuestros compañeros primero. Por favor confírmalos al
menos.”
“Oh bueno, son todas lindas chicas. ¿Son
todas las preferencias de Maa-kun?”
“¡Tú no tienes que hacer ese tipo de
confirmación! ¡Solo paso naturalmente de casualidad! ¡Una coincidencia!”
“Ufufu. Entonces mama lo dejara como
eso.”
Mamako parecía convencida de algo a si
misma y ligeramente choco sus manos.
“Así que ahora, sigue la entrevista de
mama.”
“… ¿Hah?”
Entrevista de Mama, Mamako parecía haber
dicho eso.
“Una entrevista con Mama. Ya que son las
chicas que tal vez se vuelva la novia de Maa-kun, mama tiene que saludarlas
propiamente a ellas. Mama también quiere saber qué tipo de chicas son ellas.”
“Guh… eso es uhh…”
No era completamente imposible, más
bien, él incluso esperaba por eso un poco, pero no podía decirlo.
“¡Más que eso! ¡Esto no es lo que quería
decir! Es sobre solo eso que pasen la inspección de mama puedan volverse
nuestros compañeros, era tal cosa…”
“Parece ser interesante, así deme
infoformar que adoptaremos el sistema de inspección de madre.”
“¿¡Qu!?”
Shirarase repentinamente apareció en la
habitación, sosteniendo documentos adicionales y un conjunto de señales O y X.
En un apuro, la entrevista de mama fue
decidida.
1 Mackerel –鯖(さば) tiene la misma
pronunciación como servidor en Japonés. Terminologia gamer usada por jugadores
Japoneses.
2 Infoform – En el texto, la original [報せ] Shirase y
[知らせ] shirase
fue el chiste de entonces. Aquí el nombre NPC es [シララセ] Shirarase y el chiste continua con un extra ‘ra’ se volvió [知ららせ] shirarase.

3 Chii-su – Una
manera informal de decir hola en Japón, usado entre subordinados o compadres
hacia su jefe. En una nota aparte, la terminación –ssu es también una forma de
mostrar una relación subordinado-jefe.

Death march kara hajimaru isekai kyusoukyoku Capitulo 14-2

En La Ciudad Laberinto
Satou está aquí. Cuando vi los
inusualmente juguetes animados realistas vendiéndose con comida en una tienda
de conveniencia, recuerdo secretamente querer coleccionarlos a todos ellos. Es
la misma cosa con los gacha* en los recientes juegos sociales.
[Kiel: Coleccionables que siempre
existen en los juegos… no necesariamente en los sociales….]


“Su Alteza Real Shistina, es en verdad
un honor ser agraciados con su presencia.”
El Marques Ashinen dice tales palabras a
nosotros que visitamos la mansión del virrey.
La gente presente aquí no son solo la
pareja Marques, los nobles de la ciudad laberinto con linaje están también
alineados en la entrada.
Usualmente son los maids y los
mayordomos quienes reciben a los invitados (en la entrada), pero como esperaba
de una princesa, además, ya que es la hermana menor del siguiente rey de la
misma madre, el trato es diferente.
Después que la princesa Shistina saluda
a ellos como una realeza debería, Sera y Yo también saludamos y entonces somos
guiados al salón usual.
El salón que usualmente siento demasiado
grande ahora se siente un poco abarrotado debido a la cantidad de invitados.
Viniendo aquí trayendo un montón de
dulces como el suvenir fue una buena decisión.
“Sir Pendragon, este es un presente para
celebrar por su subida de rango de linaje y su inauguración al Ministerio de
Turismo como vice ministro. Esto no es solo de mí, sino de todas las 17 casas
nobles en la Ciudad Laberinto.”
El Marques Ashinen me da una pequeña
caja que ha sido cuidadosamente tallada.
Siguiendo detrás de él, los otros nobles
también me felicitan.
“¿Puedo abrirla tal vez?”
“Umu.”
Abriendo un presente como este
inmediatamente después de recibirlo es la manera propia en el Reino Shiga, pero
inadvertidamente pregunto debido a mi naturaleza Japonesa.
–Geh, ¿es en serio?
Mi sorpresa sobrepasa la habilidad Poker
Face como miro el contenido de esa pequeña caja.
“Valio la pena conseguir eso por todos
los medios, viendo que usted se ha sorprendido.”
“… M-muchas gracias.”
Saco el [Orbe Canto] de la pequeña caja
y sonrió al Marques y los otros.
De acuerdo al AR al lado del orbe,
parece ser algo del [Laberinto Chupasangre] del Imperio Saga.
Esta un [Orbe Magia de Luz] al lado de
este.
El Orbe Canto tal vez sea un extra.
Ellos deberían ser bastante raros, pero
conseguir abundantes orbes justo cuando no los necesitas pasa en juegos y en el
otro mundo al parecer.
Fue bastante inusual para mi mostrar un
deseo banal, así que ellos preguntaron a los mercantes para mirar por ellos
como un regalo sorpresa.
Estoy muy agradecido. No es como
pensara, “solo que fue de todos mis esfuerzos por esto”, no destello en mi
mente, pero murmura eso después de ir a través de un montón de problemas por mi
bien podría hacerme conseguir un golpe con una retribución divina.
Me siento mal por solo recibir cosas,
así que señalo al mayordomo del marques y hago sacar los suvenires que le pase
a él antes.
“¡Estas son la tiara y la esmeralda que
vi en ese entonces! Así que lo recordaste.”
“Si, son artículos adecuados para la
Marquesa después de todo.”
Estoy en deuda con la Marquesa que me
ayudo para hacer las conexiones personales en la Capital Real, así que conseguí
la [Tiara] y el [Esmeralda tamaño-huevo] que ella quería.
He succionado un montón de dinero de los
nobles del a Capital Real, así que compre estos sin problema y todo.
“¡Mi! Qué hermoso trabajo de cristal.”
“¿Satou-sama, es esta escultura el
trabajo de un taller de la Capital Real?”
“¡Admiren! Esta pequeña escultura parece
como si estuviera viva.”
En adición a eso, presente otras cosas
como la estatua de cristal del rey ancestral y estatuas de cristal de pequeños
animales para los sirvientes.
El primero fue bien recibido como
planee, pero parece que la marquesa y las esposas nobles les gustaron los
segundos también.
Fueron fácilmente hechos con mi magia
original [Arte de Cristal], un hechizo creado por [Arte de Lodo] y [Arena a
Cristal].
Al principio hice esta magia ya que
quería un cuenco con acabado de hielo, pero parece que puedo usar esto para
varias cosas aparte.
“Marques, he dejado el nuevo trabajo al
mayordomo, por favor disfrútelo.”
“… ¿P-por nuevo trabajo quieres decir
una obra de arte?”
“Si.”
Causaría discordia si solo doy el
presente a la Marquesa, así que no he olvidado al Marques también.
Su presente no es mi propio trabajo,
sino una [Estatua Desnuda de Hombre] que conseguí de la Capital del Ducado
usando Mover Unidad. El Marques una vez dijo, “Mi amigo obtuvo el nuevo trabajo
en la Capital del Ducado.”
Les di un set hecho de la Firma Echigoya
de [Medicina Vitalidad], [Medicina para la Piel], [Formula para Crecer Cabello]
a cada cabeza de las casas nobles. Parece que fueron duras de conseguir en la
ciudad laberinto, así que exageradamente complacieron.
Después de haber terminado el
intercambio de suvenires, fue tiempo para la charla placentera como siempre.
Lo que fue diferente era que ellos
querían que yo hablara sobre el asunto del ataque del demonio sakuramochi en la
Capital Real, y el Héroe Nanashi y los Caballeros Dorados.
Ha sido ya un mes y medio desde el
incidente, así que los detalles deberían haber circulado en la ciudad laberinto
también, pero ellos probablemente quieren escuchar la historia desde la gente
que estuvo ahí.
“–La reconstrucción de la Capital Real
está yendo bien no es así.”
“Si, son el resultado de los esfuerzos
del Héroe Nanashi.”
La princesa responde a la Marquesa con
una sonrisa clara.
Por favor deja de mirarme cuando estás
diciendo Héroe Nanashi.
Después que la plática seria termino,
esta vez nos movemos a historias de amor.
“Quiero escuchar el comienzo del amor de
la princesa y Satou-dono.”
“Nos conocimos por accidente–”
Una de las condesas del círculo de la
Marquesa pregunto sobre el tema.
La princesa entonces hablo sobre como
ella me conoció con Arisa y Mia como el intermediario, y como la salve cuando
un monstruo ataco como si contara algún tipo de cuento heroico.
Por supuesto ella corto el asunto sobre
Hisui y mi acción sin sentido.
“Quiero escuchar sobre el comienzo del
romance de la『Miko del Oráculo』Sera-sama. Eres una sirviente para el vice ministro, pero de hecho,
eres la candidata para la segunda esposa ¿correcto?”
La vizcondesa pregunta sobre los
objetivos reales de Sera.
“Si, tal vez se tome así. He adquirido
el permiso del abuelo y padre después de todo–”
Después de decir así, Sera volteo hacia
mí mientras sonríe.
… ¿Es la primera vez que escucho de eso
creo?
“Sera-sama, creo que sería mejor si
hablas sobre eso una vez sea oficial.”
“Si, tienes razón.”
Le advierto a Sera ya que sería
problemático si algunos extraños rumores circulan.
Ella obedientemente asiente, y cierra la
plática incierta.
Cada que Sera arregla su asiento, ella
se acerca a mí, me pregunto si es solo mi imaginación…
Siento como ella está sepultando la boca
del otro poco a poco.
Aun así, estoy agradecido que deje a
Lady Karina en la mansión.
Tengo el presentimiento que hubiera sido
más problemático si ella estuviera aquí.
Después de terminar la fiesta del té,
vamos hacia las barricadas del Ejercito del Laberinto.
“““¡Joven Amo! ¡Bienvenido de Vuelta!”””
Aquellos saludos vienen de algunos
pueblerinos desconocidos y exploradores cuando pasamos a través de los puestos
de comida para exploradores y la calla en frente del Gremio de Exploradores.
Por ahora, sacudo mis manos a través de
la ventana.
“Eres bastante popular.”
La princesa parece ligeramente
sorprendida por mi popularidad.
“Ellos probablemente recuerdan mi rostro
del desfile por la subyugación del『Maestro de Piso』.”
“Satou-san, no tienes que ser tan
modesto. Los logros de Satou-san son famosos incluso en la Capital Real.”
“Estas exagerando.”
Respondo a Sera con una sonrisa agria,
volteo alrededor para ver algunos pequeños animado fuera de la ventana.
“Vizconde-samaa”
“Joven amoo”
“Satou onii-chaan”
Fuera de la ventana del carruaje, veo
pequeñas niñas y niños corriendo detrás del carruaje.
¿Son los niños del orfanato?
Silenciosamente apoyo a los niños que ha
tropezado con sus pies con [Mano Mágica].
El tráfico disminuye antes de saberlo, y
el carruaje llega al destino.
Hemos arribado a las barracas del
ejercito del laberinto, saludamos al General Eltar y visitado a los soldados.
Solo traje algo de licor y salmón sakura
ahumado de la capital real como suvenir para el general y los soldados, no es
nada especial para mencionar.
Estas fueron las conversaciones a lo
mucho.
“Se debió haber sido ofrecido un asiento
de las Ocho Espadas Shiga, ¿Por qué lo rechazaste?”
“Eso es demasiado de un asunto para mi.
Ser una de las Ocho Espadas Shiga requere la fuerza individual de uno después
de todo.”
El General Eltar asiente a mi respuesta
mientras acaricia su barba.
En la ciudad laberinto, parece que soy
conocido más como el propietario que tiene establecido un lugar de
entrenamiento para exploradores y un orfanato, y también un político que está
alineado con la facción con la marquesa más que un exploradores después de
todo.
“Así que, vas a ir alrededor del mundo
como el vice ministro del Ministerio de Turismo, ¿qué es lo que tus sirvientes
van a hacer?”
“Liza y las otras van a continuar a
explorar el laberinto.”
“Ya veo–”
¿Quizás, él va a invitar a Liza y las
otras al ejército del laberinto?
O así pensé, pero el General Eltar dice
algunas cosas inesperadas después.
“Si vas a establecer una orden privada
de caballeros en la ciudad laberinto, puedes consultarme.”
No quiero hacer algo como una orden
privada de caballeros.
No es como fuera a participar en una
guerra de todos modos, no necesito una orden privada de caballeros, ¿correcto?
O más bien, si hago una, eso podría ser
una excusa para comenzar una guerra.
Así pensé, pero ya que él dijo eso fuera
de amabilidad, respondo como un Japonés que puede leer el ambiente.
“No he pensado sobre eso por el momento,
pero sería un placer si puedo consultar contigo cuando ese tiempo venga.”
“Umu, puedes libremente venir aquí.”
El General Eltar asiente como está
satisfecho con mi respuesta.
Si necesito consultar con él, no traeré
una botella de licor de fuente de dragón, sino un barril completo.
“““¡Joven Amo! ¡Vamos a tener un festín!”””
Cuando fui al Gremio de Exploradores
oeste para visitar al maestro de gremio, los miembros de personal ebrios y
exploradores me saludan unánimemente.
Parece que ellos abrieron el barril de
licor que envié al maestro de gremio y los miembros de personal, y han
comenzado una borrachera ya.
El sol está aún en alto, ellos ponen a
los dwarves en vergüenza…
“¡Ou! ¡Satou, este es un licor bueno!
¡Desaparecerá si no vienes pronto!”
La maestro de gremio grita con una
sonrisa desde el centro de los ebrios.
Me gustaría participar si estuviera
solo, pero ya que estoy con la princesa y Sera, eso sería malo.
“Satou-sama, vamos a tomar parte juntos
con usted.”
“¿Eh? ¿S-su alteza?”
Parece que la princesa es una bebedora
regular, ella jala mis manos y camina hacia la maestro del gremio.
“¿Oh? ¿Eres ya metida en estos cortos
asuntos? ¿Primera vez que nos conocemos supongo, su alteza princesa?”
“No, una vez tome una lectura por la
mago de fuego durante un vals en la Capital Real.”
“¡Ah! ¡Esa pequeña princesa huh! ¡Pensé
que eras una extraña princesa, pero de seguro tienes buenos ojos para hombres!”
“¡Si!”
Parece que la maestro de gremio es
conocida con la princesa.
La princesa bebe el licor que la maestro
de gremio vierte. Ella es una bebedora bastante buena.
El movimiento de su garganta bebiendo el
licor se ve cautivante.
Mientras estaba siendo cautivado por la
princesa, Sera que está sentada al lado mío pincha mi regazo.
Sera bebe la copa de licor dada por el
Miembro de Personal A con una expresión refunfuñona.
“¡Satou-san! Satou-san es–”
Habiendo bebido el licor, Sera
vigorosamente dice mucho entonces ella repentinamente cae en mi hombro como si
su batería fuera cortada.
Aparentemente, Sera que ha crecido en el
templo es débil ante el licor.
En la otra mano, la princesa está
bebiendo de igual con la maestro de gremio.
“Esa fue algo de buena bebida.”
“Bebo un montón en las fiestas nocturnas
para excusarme a mí misma de salir, así que me volvió fuerte a esto antes de
saberlo.”
Ya veo, muy como la princesa.
“Satou es un barril sin fondo también,
ustedes dos serán una buena pareja.”
“Gracias.”
Sin pensar en la maestro de gremio que
la llamo con [Tú (anta)], las mejillas rojas de la princesa por el licor se
enrojecen incluso más y le agradece a ella.
Mirándola a ella, uno de los hombres
grito, “¡Explotar Riajuu!” con profundo resentimiento.
Quien divulgo la palabra “riajuu” tal
vez sea Arisa.
Durante el asunto de beber, platico con
la Elfo Ms. Sebelkea y la gerente del gremio sobre sus trabajos.
El asunto es sobre la administración del
gremio como pidió el Conde Seryuu.
“¿La compensación?”
Ms. Sebelkea pregunta cortamente como un
elfo podría.
“Por favor mire a esto.”
“¿Hou? Ellos dan la prioridad a
comerciar los materiales de wyvern y continuo suministro de piedras de dragón
blanco huh…”
Entrego los documentos del Conde Seryuu
a la gerente.
Ms. Selbekea muestra la sombra de un
veterano adecuado a su edad en su sonrisa como chica joven.
La piedra de dragón blanco es el
material para hacer el antídoto todo-propósito y la luz a materiales de wyvern
con alta defensa son algo que avanzados exploradores desean conseguir a
expensas del costo.
El antídoto todo-propósito
especialmente, nobles que tienen un montón de enemigos constantemente buscan
por esto, así que la demanda para esto es innegable.
Al principio había algo de algunas
hierbas medicinales necesarias para medicina recuperadora de estamina, pero
ahora que ellos pueden producir medicina mágica de la beria loca la demanda ha
sido abatido, yo cancele el plan.
“Parece como el Conde Seryuu ha sido un
excelente consejero.”
“Algunos benefactores y conocidos míos
están en el Condado después de todo.”
Eludo la provocación de Ms. Sebelkea sin
un ajetreo.
“Muy bien. Tendré la firma de la maestro
de gremio luego.”
Fui finalmente capaz de conseguir su
consentimiento.
“¿Puedo usar empleados temporales para
la escuela de exploradores para enseñar el curso de la gerencia?”
“Si, los traeré a ellos mañana para
visitar aquí.”
“Entendido. Dejado eso de lado, Satou.”
Terminando la plática de trabajo, Ms.
Sebelkea que perdió su expresión firme, cambia de vuelta al modo fiesta, y
habla también conmigo.
“Nuestros Altos-elfos-sama
frecuentemente preguntan sobre ti, ¿tienes alguna idea?”
“No, no lo sé.”
Si ellos tuvieran algunos asuntos
conmigo, ellos pueden siempre llamarme a través de Aze-san, y los elfos de
bosque que estaban en peligro del Kaijuu Espacial fue un clan diferente al de
Ms. Sebelkea, así que en verdad no tengo la más ligera idea.
“Solo en caso, Satou es humano ¿correcto?”
“Si, por supuesto.”
Aunque inmediatamente respondí a la
pregunta confusa, estaba confundido en mi mente.
Ha habido varios casos donde esa
confianza fue perdida recientemente, pero mi raza es aún escrita como human en
la pantalla de estado.
Ms. Sebelkea asiente a mi respuesta como
ella está satisfecha, y bebe el vino feérico en su mano.
Va a haber un banquete en la mansión del
virrey esta noche, así que me excuso de la ronde de bebidas antes que la
princesa caiga.
Parece que la princesa esta envidiosa de
Sera que está siendo cargada por mí con una cargada de princesa, ella apoya su
cabeza en mi hombro mientras se comporta como una niña malcriada durante el
corto tiempo del carruaje de regreso, y deja salir un suspiro feliz.
Hay algo de tiempo antes de la cena, así
que voy solo a la mansión donde la gente del Conde Seryuu se está quedando en
la ciudad laberinto.
Parece que el conde les dijo sobre mí,
ellos fácilmente me reciben.
“–¿entrenamiento para gerencia?”
“Si, la maestro de gremio ha amablemente
aceptado. Por supuesto, la consejera, Ms. Sebelkea, y la gerente han respondido
complacientemente también.”
La oficial civil abre sus ojos
ampliamente cuando ella escucha sobre la cosa de gerencia.
Hay también alguna gente que dice, “Solo
como”, o “¿acaso él uso las conexiones de la Marquesa”, en voz baja.
Planeo presenta los oficiales civiles a
Ms. Sebelkea mañana en la mañana.
“Y para la unidad en sitio, el equipo de
Exploradores Mithril,『Hacha de Flama Azul』van a enseñarles.”
“¡¿Mi-Mithril?!”
Al capitán de la unidad en sitio,
Caballero Henz, se puso de pie y pateo la silla abajo debido a la sorpresa.
Los soldados comenzaron a ser ruidosos.
El Hacha de Flama Azul que mencione es
uno de los equipos que subyugaron al maestro de piso junto con Jeril y su
equipo.
Intente negociar con todos los equipos
prominentes durante mi estadía en la Capital Real, pero la Hacha de Flama Azul
fue la única que consintió esto.
Su recompensa es una presentación a la
Firma Echigoya.
Usando la carta de presentación que
conseguí por el primer príncipe Soltrick de antes, parece que los miembros del
equipo Hacha de Flama Azul ordenaron armas mágicas y varas que querían.
Solo intermedie entre ellos y cargar el
dinero de sus fondos.
Encima de asegurar personal, conseguí
para ellos experimentar–er, comentar de las nuevas armas, no hay pérdida para
mí.
“Si, vamos a tener una presentación
forma mañana en la mañana.”
Después de decir así, explico la ruta
para la exploración con el mapa y el programa al Caballero Henz.
Pociones de recuperación hechas de beria
han sido popularizadas, así que debería no ser problema incluso si eligen una
ruta ligeramente peligrosa.
Ellos tienen fuertes cadetes también.
“Vizconde-sama, ¿carecemos de un soldado
mágico en este plan?”
EL Capitán Riro que revisa los
documentos al lado del Caballero Henz me pregunta sobre Zena-san que no está
incluida en el programa.
Si no estoy equivocado, él es el
superior directo de Zena-san.
“Ella ha sido transferida al Ministerio
de Turismo para actuar como un guardia y también una secretaria. El Conde
Seryuu yy Marientail.san han consentido esto, así que por favor no se preocupe
sobre esto.”
Aunque pensé lo mismo, el rostro del
capitán Riro aun parece abrumado.
Justo entonces, Zena-san parece junto
con los miembros del Escuadrón Zena.
Las chicas han transportado caballos así
que tenían que volver a través de la ruta por tierra, parece que consiguieron
llegar a la ciudad laberinto a buen momento.
“¡Vice cabeza del Escuadrón Zena, Iona y
tres miembros, han regresado a la ciudad laberinto!”
Ms. Iona reporta no al Caballero Henz
sino al Capitán Riro.
Me pregunto si es porque es su superior
directo.
Después de agradecerme, el Capital Riro
confirma con Zena-san que está en uniforme militar sobre el asunto de antes.
“S-si, No es una equivocación. Estaba en
el lugar cuando Conde-sama aprobó esto.”
“Ya veo–”
El capitán Riro finalmente es convecido
después que Zena-san lo asegura.
Algunas voces ruidosas vienen desde
detrás de él.
“¿Esta Zena-san bien sola?”
“¿Acaso quieres ir también?”
“¡Lo hiciste, Zena-cchi! ¡Ahora el
asiento de la doncella es certero para tí!”
Cada miembro del Escuadrón Zena llaman a
Zena-san.
“Asombroso, Vizconde-sama es tan genial
como Vizconde Belton ¿no es así?”
Respondiendo a Lilio, una chica soldado
llamada Gayana hace un remate.
“¡Esta casándose con un hombre rico!”
“Asombroso.”
“¡Invítame a algo la próxima vez okay!”
Las otras soldados femeninas también
animan a Zena-san.
En la otra mano, humor sombrío de
depresión y celos viene fluyendo de los soldados hombres.
Así que en verdad había un montón de
fans de la lindura plana de Zena-san después de todo.
Los cuatro de nosotros incluyendo Lady
Karina vamos al banquete y saboreamos en los elegantes platillos hechos por el
chef de la mansión del virrey.
Cuando dejo mi asiento durante la
llamada de la naturaleza, la informante de la Marquesa me contacta, vistiendo
ropas de maid.
“Así que parece que estas enganchado con
la princesa. Estoy celosa–”
“Dejando eso de lado, ¿tienes alguna
nueva información?”
Detengo el servicio de la informante y
le urjo a corta a lo que sigue.
Algunos malos rumores podrían flotar
alrededor si me miran demasiado cercas de una maid en la mansión del virrey
después de todo.
“¿Has escuchado que tres reinos vecinos
al Sagrado Reino Parion se unieron y atacaron hace dos días?”
“No, es la primera vez que lo escucho.”
Como siempre ella consigue información
de las naciones del Oeste rápido.
“Fue un gran ejercito de un total de
60.000 tropas.”
–En pasado huh.
“De acuerdo a la información que justo
vino, ese gran ejercito fue tirado abajo por los 10.000 fuertes del Sagrado
Reino Parion auto-llamado『Ejercito de Dios』, y fueron repelidos de regreso a sus propios reinos.”
Santo cielo, por favor paren de usar
peligrosas palabras como [Ejercito de Dios].
Tengo miedo que en verdad termine
levantando una bandera para una pelea contra el Apóstol de Dios.
–Sin embargo, hay algo que quiero saber
primero.
“¿Por cierto, sabes la razón de porque
los tres reinos se unieron?”
“Es una historia absurda–”
El informante está vacilando a responder
mi pregunta.
Después de vacilar con sugestivos
gestos, ella abre la boca.
“Ellos claman que el papa del Reino
Sagrado Parion, Zazaris, es un señor demonio.”
…Aparentemente, mi viaje por el mundo no
comenzara por un rato.
◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇ ◇

Post Informativo

Buenas que tal soy el disque traductor Suraga trayéndoles algunas noticias.

Primero que nada sobre Yurushia creo Khiel ya les comento que tengo editor de esta novela su nick es Alphard bueno técnicamente todavía no es mi editor oficial pero me ayudo con la edición del volumen 02 y aun me ayuda con los que están saliendo del 03, he estado reemplazando los caps y pronto terminare de hacerlo cuando lo haga empezare ahora si con el pdf.

Lo segundo no se los haba dicho pero decidí cambiarles el nombre a la Raza Demonio por la de Majins(esto también fue por la recomendación de Alphard) la razón es para diferenciar a los demonios como Milaine que pertenece a la raza demonio originaria del plano material de los Demonios como Yurushia que son originarios del plano espiritual los cuales son verdaderos demonios por lo tanto serán la raza majin, también el Rey Demonio sera cambiado a solo el Maou este es mas por que me parece que suena mejor bueno de Yuru-tan creo es todo.

Por ultimo esta semana pasada solo fueron 2 caps de yuru y esta no creo poder sacar el que les debo pero alegrence no todo esta perdido para ustedes ya que traduciré una nueva novela ya le comente a Khiel aunque olvide decirle cual era xD y aunque dije todo esto no se alegren tanto que apenas fue comenzada su traducción al ingles, el gringo que la traduce solo lleva la pre-cuela y el prologo y aunque ya era lento anuncio que estaría mas lento por lo que yo también me tomare mi tiempo al traducirla xD por cierto esta es una light novel por lo que el puro prologo esta larguísimo y dividido en tres partes o eso creo bien pues es todo no leemos despues.

P. D. Olvide mencionarlo pero estaba tomando clases de ingles y por razones fuera de mi poder decidí pausarlas un tiempo sip las pausare pero no planeo dejarlas pero por lo pronto mi traducción así como mis dolores de cabeza no mejoraran xD

P. D. 2. También se me olvida pero el nombre de la novela es Choujin Koukousei-tachi wa Isekai demo Yoyuu de Ikinuku you desu! escrita por Misora Riku (Autor de Rakudai Kishi y Ultimate Antihero) espero y no la cague como con Antihero xD

ahi dejo la sinopsis:

7 estudiantes de preparatoria que se vieron atrapados en un accidente de avión despertaron, en un mundo diferente medieval de fantasía donde la magia y los hombres-bestia (juujin) existen.

¡¿Pero no se preocupan por su situación actual!?

Ellos construyen una planta nuclear en un mundo sin electricidad, controlan la economía de una gran ciudad en un corto viaje de trabajo y, finalmente, por el bien de sus benefactores que están sufriendo el mal gobierno, declaran la guerra a los malos nobles.

Así que… ninguno de ellos es un estudiante de preparatoria normal, cada uno de ellos es un super-estudiante de preparatoria que están en la parte superior de la política, la economía, la ciencia y la medicina!

Esta es una historia de un equipo de ensueño que poseen la mayor sabiduría y tecnología de la tierra, que sin ningún tipo de autocontrol traen una revolución a un mundo diferente con la sobre-tecnología!