Okaa-san Epilogo y Palabras del Autor

Bueno minna, con esta parte se termina ‘momentáneamente’ Okaa-san y pasaremos a otra novela ‘temporalmente’…

No se preocupen, no la dejare de lado, simplemente quedara en espera hasta que Frozen-senpai traduzca el volumen 2 en un futuro no muy lejano… kamo…


“¡Ah geez, tan irritante! ¿¡Qué es
esto!? ¿¡Qué es lo que quieres de mí!? No es tu asunto de todos modos, ¿¡lo
es!? ¡En cualquier caso, estamos dentro de un juego! ¡Deja a mama hacer lo que
“¡Este es el resultado de hacer lo que
querías! ¡Has causado un montón de problemas a todo el mundo involucrándolo!
¿¡Además, que con eso!? ¿¡Hacer muebles de chicos guapos, estas demente!?
¡Incluso estar alrededor por anfitriones normales son aún mejor que eso!”
“¿Es eso así? Entonces hare solo eso.
Genya, por favor dame algo de dinero. Has estado trabajando a tiempo parcial,
“¡No digas cosas estúpidas! ¿¡Solo que
tan peor mama puedes llegar a ser!? ¡Sera mejor que pares eso ya! ¡En seriooo
detén eso!”
“¡Ah geez, cállate! ¡Haciendo sonidos
gya gya gya gya de nuevo! ¡Genya es siempre como eso! ¡Siempre haciendo ruidos
gya gya desde el momento que saliste de la entrepierna de mama!”
“¡No digas cosas como salir fuera de tu
entrepierna! ¡Y no me llames por mi nombre real!”
“¿En que estas insatisfecha, Genya? No
es ese un buen nombre… Aah, quiero encontrármelo de nuevo, después de un largo
tiempo… está haciéndolo bien, mi número uno, Genya. Tengo que traer una botella
cuando vaya a esa tienda la próxima vez.”
la ira de tu hija que le fue dado el nombre de su favorito
“¡Volveré a reprender a mi hija idiota!
¡Hare que ese pecho pettanko sea incluso más plano!”
“¡Te voy a mandar a volar junto con mi
rencor por hereeeeeeeeeeeeeeencia!”
Wise se volvió un demonio de ira y la
En la otra mano, la Reina de La Noche
que regreso a su apariencia humana después de remover su transformación
mágica—La madre de Wise, Kazuno, que lucía como una ama de casa de mediana edad
ordinaria, también peleo en defensa.
Aquellas dos se tomaron una a la otra,
golpeando sus frentes juntas, entonces Kazuno inmediatamente cambio su postura
y empujo sobre Wise, ejecutando un newaza[1] en ella…
“… Ah.”
“¿Hmm? ¿Qué? ¿Qué ocurre?”
“N-No, es que… como podría poner esto…
cuando huelo la esencia de mama, es un poco…”
“Hey, no digas repentinamente ese tipo
de cosas… Genya también, puedo oler tu hedor que me da una sensación que eres
la niña de mama después de todo.”
“Muu. ¡Siento que esa manera de decirlo
justo ahora fue extraña! ¡Tus palabras parecen sugerir que soy olorosa!”
“Ah, ¿entiendes eso? Porque tu sudor es
“¡Tú también! ¡Mama apesta! ¡De alguna
forma me recuerdas a una persona vieja!”
“¡Detente un minuto, refuta ese remarque
justo ahora! Mama es sensible sobre eso, ¿¡sabes!?”
Bueno, eso es como el sentimiento de
Por ahí, Masato y Shirase estaban
mirándoles desde lejos.
“Eeh, después de tocar escena, una pelea
padre-hijo salió fuera, huh… no diré que eso también muestra como de cercanos
son, ¿pero qué es lo que piensas?”
“Déjame ver… hay quien dice que una riña
es la evidencia de gente siendo cercana… siempre y cuando no den problemas a
aquellos alrededor, bueno, vamos solo a tomarlo como una buena señal.”
Esa fue también una manera de ser un
padre e hijo, eso tal vez sea bueno en su propia manera.
“Así que, ¿Qué pasara con la madre de
“Primero, ella tiene que desconectarse,
entonces vamos a escuchar su historia.”
“¿Y ella encarara un duro castigo?”
“No podemos dejar de lado el uso de una
herramienta trampa. Sin embargo, si ella confiesa por sí misma, y provee
información beneficiosa a los administrativos desde ahora, no será difícil a
reducir su castigo. Aunque si es como eso, son aún son un apropiado par de
“Es eso así… entonces, umm… ¿Qué hay
sobre Wise?”
“Como este juego significa para
participar como un duo de padre e hijo, basados en la aptitud de Kazuno-san, me
temo que hay una posibilidad que la cuenta de Wise también sea suspendida…”
Shirase echo una rápida mirada al anillo
en el dedo anillo izquierdo de Masato.
“Pero ya que no soy tan aburrida como
para apartar a dos adolescentes, por favor tranquilice sobre eso. También tener
un nuevo par de padre-hijo desde el juego es también un resultado alegre para
nosotros… Sin embargo, sea precavido de su edad de matrimonio, por favor
respete a ley.”
“¿Hmm? ¿Hmm? ¿Hmm? ¿No entendí que estás
“Ah bueno, dejando eso de lado.
Masato-kun y Mamako-san hicieron una gran contribución. Viendo a los dos
mostrar esa fuerza padre-hijo, fui impresionada. Fue esplendido.”
“Gracias… Pero la secuela está
volviéndose en verdad seria…
Él miro atrás lentamente.
“¡Mama-san, eres tan deslumbrante!
¡Justo como un sol! ¡Es cegador!”
“Lo siento por ser tan brillante.
Trabajar duro junto con Maa-kun, mama fue tan feliz… Aah geez, el corazón de
mama está aún palpitando tan rápido…”
Mamako estaba charlando con Porta atrás,
pero su【Luz de Madre】activada por
su gran humor fue tan brillante que ya no podían confirmar la figura de Mamako.
Era demasiado deslumbrante.
“Creo que será mejor si ajustas las
habilidades de mama un poco.”
“Fum, ya veo. Entonces reportare esto
como retroalimentación de jugador de prueba. ¿Hay alguna otra cosa que podría
gustarte a improvisar?”
“Otras cosas… vamos a ver… algo sería…”
Y, mientras estaba pensando, Masato
bostezo fuertemente. Aunque su HP se había recuperado, la fatiga aún
“Probablemente estás cansado. En ese
caso, Masato-kun y Mamako-san deberían regresar a su posada primero y
descansar. Ese molesto par de ahí parece requerir algo más de tiempo, así que tomare
mi ida primero.”
“Molesto par, dices… entonces bien,
tomare tu oferta. Porta, ven con nosotros también…”
“¡No! ¡Puedo leer el ambiente! ¡No puedo
interrumpir el llevarse bien entre madre e hijo!”
Él quería que viniera ella porque
encontraba ese tipo de situación un poco problemática, pero no se pudo evitar
que ella rechazara por pura preocupación.
Y, bueno, no odiaba estar a solas con
“Entonces mama, vamos a ir de regreso
“Seguro. Entonces nos vamos. Aah, es
cierto, Maa-kun. ¿Qué deberíamos hacer después de regresar? ¿Quieres ir a las
aguas termales? ¿O al super? O, ¿dormir junto a mama? Oh tú☆” *¡Brilla!*
“No te descarriles. Y deja de brillar. Y
quiero tener udon del super.”
“Lo tengo. Entonces mama usa todas sus
habilidades para cocinarlo… Ufufu.”
“¿Q-que sucede contigo? Repentinamente
sonriendo como eso.”
“Porque es raro para Maa-kun decir lo
que quiere comer. En casa, siempre es ‘Lo que sea’ o ‘Lo de siempre’. Mama se
sentía solitaria, ¿sabes?”
“L-lo siento…”
“Y como esto, propiamente hablando
fuera, somos capaces de tener una conversación… mama es en verdad feliz…
Y, una delgada capa de lágrimas salió de
los ojos de Mamako.
“Heh, ¿¡porque estas llorando!? ¿¡Esto
no es algo por lo que tengas que llorar!?”
“Ufufu. Eso es verdad. Mama es rara por
repentinamente llorar como eso, ¿cierto?”
“Totalmente… haa… mi madre es un ser que
no entiendo para nada…”
“Tal vez. Un chico no sea capaz de
entenderlo… Pero está bien. Está bien si no lo entiendes. Si propiamente
piensas de mama como tu mama, eso es lo suficiente bueno.”
“… ¿Es así como es?”
“Eso es como es.”
Como eso, mientras charlaban tranquilos,
Masato y Mamako caminaron uno al lado del otro.
Fue la figura de un par de padre e hijo
caminando lado a lado desvaneciéndose.
Al siguiente día.
Viéndose partir con los rostros
sonrientes del jefe de la villa y aldeanos, el equipo de Masato dejo la villa
“Gracias a todo el mundo por derrotar a
la Reina de La Noche, la villa ha regresado a la normalidad. Los jovenes
abducidos han también recuperado su cordura y regresado a sus pueblos natales.
Muchas gracias… Esto es una muestra de gratitud para ustedes de todos nosotros,
por favor acéptenlo.”
Lo que el jefe de la villa les dio, fue
un URL. Era un URL. Él fue dando gestos a tomar la línea que consistía de media
cantidad de letras y símbolos.
“Erm… ¿Qué es esto? ¿Un bug?”
“Si tu accedes esto con tu teléfono
móvil o un Smartphone, puedes descargar un alojamiento gratis que puede ser
usado en cualquier hotel de aguas termales desde la Asociación Nacional de
Aguas Termales. Por favor úselo bien, todo el mundo.”
“¡El alojamiento de posada gratis ha
llegado!” Wise fue super agradecida☆
“¡Qué asombroso presente!” Mamako fue
“Ustedes dos de ahí, no se pongan tan
excitadas. No se puede evitar, supongo.”
“No del todo. Este es una asombrosa
recompensa. Por recompensa de quest obtener algo dentro del juego para ser
usado en el mundo real, que idea revolucionaria. Por favor acéptenlo.”
“Haa… entonces, bien, lo recibiré…
Porta, por favor guárdalo dentro.”
“¡Si! ¡Por favor déjemelo a mí! ¡Lo
mantendré en el almacén del equipo!”
Porta empujo el código (en forma de
vara) URL en su gran bolso. Ahora bien.
Fue momento para irse.
El clima fue soleado. Una confortable
brisa estaba soplando. Un día perfecto para ir a un viaje en búsqueda de nuevas
“Ah, hablando de eso, Wise.”
“¿Hmm? ¿Qué?”
“¿Por qué estás aquí?”
“¿Hah? ¿¡Qué se supone que significa
eso!? ¿¡Esta insinuando que soy una molestia!?”
“¡No, no es eso!.. En primero lugar,
después de tener una riña con tu propia madre, querías volverte la hija de mi
mama por motivo de completar el juego. ¿Pero no te reconciliaste más o menos con
tu madre? Entonces no deberías tener alguna razón para estar con nosotros.”
“Ah, si… tienes un punto…”
“Es por eso, pensaba que tú deberías
cerrar sesión junto con tu mama y vivir con ella en el mundo real.”
“Ah, un, bueno… esto es que… sin
embargo, solo pensaba que quería quedarme aquí un poco más. Ya que es una rara
oportunidad, quiero tener algunas aventuras más.”
Diciendo así, Wise junto sus manos
detrás, en su espalda, y jugo alrededor con el anillo en su dedo de anillo
Incluso la persona en sí no había notado
el significado de esa acción.
“Como tal, no me excluyas de tus
compañeros. Más importante, definitivamente me necesitas, ¿no es así? ¡El poder
de un Sabio transcendental tal como yo!”
“Improvisar tu resistencia contra sello
mágico y muerte instantánea será la prioridad, pienso así.”
“¡Y-ya se eso! ¡Propiamente arreglare
mis resistencias!”
Ellos comenzaron a caminar. En búsqueda
de nuevas aventuras.
Nuevas aventuras… ¿aventuras?
“… ¿Oh? Hey, Maa-kun.”
“¿Hmm? ¿Qué sucede, mama?”
“¿Qué deberíamos hacer desde aquí en
“Que hacer… erm… ¿qué podría ser bueno?”
Como pregunto de vuelta sin pensar,
Mamako inclino la cabeza. Wise dijo “¿No lo sé?” y bajo sus hombros para
mostrarlo. Porta tenía una mirada en blanco. Una mira en blanco que quería
preservar el para siempre. Después de ver ese rostro, podría comer tres, no,
cuatro cuencos de arroz.
Y, en ese momento. Una pantalla desde un
lado del cielo, mostrando a ‘esa’ persona con rostro sin expresiones. Un par de
pupilas que recordaban la calma a pesar de la situación a la que se enfrentara.
“Buenos días a todos. Es Shirase que
esta siemrpe en la esquina de sus corazones.”
“Quiero ir a perseguirle para sacarla
fuera ahora.”
“Quiero informar que soy Shirase que
regresara ahí desconocidamente, incluso después de ser sacada… Ahora bien.
Gracias por toda la ayuda que previeron durante la quest anterior. Siguiendo
eso, hay otra quest que deseo confiarles a todos ustedes, ¿pero está bien
pedírselos ahora?”
“Otra quest ¿huh?… Hm, bueno, está
“Espera, Maa-kun. Mama ha estado
pensado, ya casi es tiempo para dejar el juego. Maa-kun tiene que ir a la
escuela, ¿cierto?”
“… Uu…”
Ese parecía ser el caso. ¿Cómo cuantos
días habían sido desde que vinieron dentro del juego? Aparte de tomar un
descanso de la escuela durante ese periodo de tiempo, si se saltaba la escuela
encima de eso, su asistencia podría estar en problemas… mientras tanto.
“No hay necesidad de preocuparse sobre
eso. En lo que están participando justo ahora es organizado por el Gobierno
Japones. No importa una ausencia temporal de deberes escolares, incluso
garantizamos una fuente de ingresos y manejo de casa. Hemos cubierto todo.”
“¡Bueno! ¡Ya veo! Estoy aliviado.”
“¡Un confiable sistema de apoyo! ¡Como
esperaba de los Administrativos Gubernamentales!”
“Espero que todo el mundo continúe
asistiendo a los Administrativos en eliminar problemas en el nombre de quest
desde ahora. Esta cantidad de apoyo es todo parte del trayecto. Fufufu.”
“Podría ser bueno si no nos informaras
las especulaciones…”
“Entonces, vamos a aclarar el suspenso,
informare a todo el mundo sobre el siguiente camino que todos irán a tomar.
Shirase solo tiene a… ¡Hah!”
Proyectado en el cielo, Shirase miro al
lado, y en ese momento, un rayo de luz fue liberado de sus ojos. *Beet* Esa fue
la dirección que deberían tomar. “¿Por qué la presentación?” “Estoy
inesperadamente confundido.” Si la persona en sí lo hubiera dicho, bueno,
entonces esta bien.
Bien entonces.
“Entonces todos, la siguiente q…”
“¡Entonces todos, vamos por la siguiente
quest! ¡Ooh!”
“Mama, que es lo que dije… Soy el héroe
líder. ¿Aclaramos eso?”
“Ah, lo siento. Pero este tipo de cosas
es el primero en venir es primero en servirse. ¿Cierto?”
“Geez… bueno, eso está bien.”
Fue un asunto trivial. No fue el lugar
correcto para quejarse sobre eso. Él estaba de humor para de alguna forma
dejarlo ir.
“¡Entonces, vámonos! ¡Ooh!”
“¡Yo también voy! ¡Ooh!”
“Si si, vámonos.”
“¡Maa-kun también, sigue tras mama! ¡De
aventura junto a mama! ¡Ooh!”
“Muy bien, no te dejes llevar, madre.”
Ligeramente asombrado con Mamako en alto
espíritu, Masato también comenzó a caminar.
Y, en ese momento, Masato repentinamente
recordó. Hablando de algo…
[P: ¿Te volverías más íntimo con tu
madre si vas en una aventura junto con ella?]
Antes que estos días comenzaran, esa
pregunta fue dicha en la encuesta.
¿Qué respuesta podría haber escrito
“… ¿Probablemente? Como podría saberlo.”
Al final, murmuro aquellas palabras que
no diferían de antes a que su aventura había comenzado.
Con una sonrisa en su rostro que incluso
el mismo no noto, Masato fue detrás de la espalda de su madre.
[1] Newaza – 寝技 Una técnica
de Judo japonés.
Palabras del Autor
Este es mi primer encuentro con todo el
mundo. Inaka Dachima, Inaka Dachima es mi nombre. En esta ocasión, les
agradezco mucho por comprar mi trabajo.
En este libro, la madre es la heroína
principal. Respecto a esto, incluso el editor a cargo también describió esto
como [Es una idea bastante innovadora].
Eso es, bueno, también cierto. Las
heroínas de las novelas ligeras son existencias que nacen con la meta de ser
amadas pasionalmente por sus fans. Ella siendo una madre… a menos que uno sea
un veterano, será bastante imposible hacer de ella una waifu.
Sin embargo, eso está bien.
Mamako no es la heroína que deberías
amar, sino es la heroína que te ama. Ella es una madre que reconoce todo sobre
ti, lo acepta y lo ama profundamente.
Como tal, para aquellos que tal vez
piensen “Pero ya tengo waifu(s)…” también, espero que se sientan libres de
colocar este trabajo en una esquina de sus libreros. A ella no le molestara.
Mamako estará gentilmente observando por
ustedes, mientras están haciéndolo fuera…
Eh, ¿eso sería duro a hacer? Bueno, eso
es verdad. Pero por favor hagan algo sobre eso. Por favor háganlo.
Tome prestada esta ocasión para
agradecer a todo el mundo.
A los queridos miembros del comité de
selección que han elegido este trabajo para ser el ganador del primer premio de
la 29ma Fantasía Grand Prize, muchas gracias a todos.
De paso, a Iida Pochi a cargo de la
ilustración, la gente encargada en publicar este trabajo, y K-san a cargo de
editar, déjenme ofrecer mis disculpas y gratitud, por favor tengan paciencia
conmigo y cuiden de mi en el futuro también.
Finalmente. A mi madre que regreso
después de volverse una empleada contratada después de pasar la edad y obtener
una licencia de trabajo para mayores, deseo ofrecer este trabajo para ti.[K]
Tal vez sea problemático para ti, que ya
es una abuela con un nieto, a dedicar tu tiempo para novelas ligeras… Eh,
¿leerlo? ¿Vas a leer esto?
Entonces, adelante. Sin embargo, por
favor perdóname por darme un sermón cara a cara.
Año 2016 ・ Otoño Inaka
[K] Esto es respecto a que las personas
mayores luego de llegar a la edad de jubilación, depende del país pero aquí en
mi país es de 60 años máximo, en Japón ellos pueden continuar dando labores a
la comunidad pero bajo cierto tipo de trabajo o consiguiendo una licencia que
avala que aún son aptos para dichos trabajos…

Google-sensei les puede dar una
información más detallada para a quien le interese.

Okaa-san Capitulo 5 (Parte 2)

“¡No me malentiendas! ¡No es como que
quiera hacerlo, solo decidí encontrarme con mama una vez más porque Mamako-san
me lo dijo! ¡Bueno, no me lastimara llevarme bien con ella un poco, eso es todo
lo que diré!”
“Si si, dices eso. Consiguiendo un
abrazo de mi mama, bien por ti.”
Aunque ella estaba haciendo un alboroto
con excusas, bueno, a él no le importaba.
“¿Cómo va, Porta?”
“¡Puedo oler la fuerte esencia de su perfume!
¡Por este camino!”
“Porta-chan es en verdad asombrosa
después de todo. Ser capaz de rastrear por la esencia.”
“¡La esencia también juega un rol
importante cuando evaluó, así que propiamente he incrementado la habilidad!
¡Por favor déjemelo a mí!”
Retorciendo su pequeña nariz y olfatea
alrededor para buscar, Porta los guía dentro del profundo bosque.
Entre más profundo iban, más ramas y
hojas cubrían el cielo sobre sus cabezas, causando que la luz de luna que
brillaba se atenúa. Ellos fueron envueltos en oscuridad como avanzan, pero su
meta era más dentro. Incluso más adentro.
Después de caminar un momento, Porta vio
“¡Ah, veo algo!.. Eso es…?”
Era una misteriosa escena ante ellos. Un
ataúd estaba atascado en un tronco de árbol. Parece que alguien había muerto
por ahí.
“Considerando el ataúd que apareció ante
nosotros repentinamente, solo pienso en una persona.
“Yo también pienso en esa persona.
Entonces, rápidamente la revivire… Supra・La・Magia・Peru・Mirare…
¡Reanimato (Resurrección)!”
Después Wise uso magia de resurrección,
el ataúd se vaporizo, revelando la figura de una monja que estaba dentro. Fue
de hecho esa persona. Una conocida que se llamaba a sí misma una Monja
Misteriosa, Shirase.
“… Son ustedes gente. Parece que he sido
salvada de nuevo. Lo siento por causar problemas de nuevo y de nuevo.”
“No no, he conseguido bastante usando
esto. No necesitas disculparte.”
“Sin embargo… si es posible, por favor
hagan algo sobre mi condición de ser perforada por una rama de árbol… regresando
a la vida, quiero yo… informar… Shira…se” *Gaku*
“¡Lo siento por no notarlo!”
Shirase fue revivida, pero entonces
murió de nuevo. Fue fácil revivir la muerte con magia, pero también tenía que
encargarse de eso luego. “¡Masato! ¡Sostenla ahí!” “¡Lo tengo!” Ella tiro abajo
el árbol y la revivió de nuevo.
Una vez más, el equipo de Masato se
reunió con Shirase.
“Es justo como pensaba. Cuando abri mis
ojos de nuevo, creía que yo iba a ver a todos con rostros sonrientes… Ahora
bien, vamos a confirmar la situación inmediatamente. ¿Cómo está progresando la
quest que solicite?”
“Va bien. La Reina de La Noche ha huido,
estamos en medio de la persecución.”
“Ya veo… entonces, ¿ustedes entienden el
trasfondo de la Reina?”
“El oponente usa magia con Cancelación
de Canto, y también tiene una defensa invencible basada en turnos, sé que ella
es bastante problemática… Otro es…”
“Ya les he dicho a ellos que la Reina es
mi mama.”
Como Wise anunció con resolución,
Shirase pensó que era un poco inesperado, como ella ligeramente elevo sus cejas
con una expresión de sorpresa. Sin embargo, pronto regreso a su usual estado
“Parece que bastante de todo ha sido
dicho. Como guía de todos, esta Shirase va a informar sobre información
adicional respecto a la Reina. Yo informare. Justo como Shirase.” *Pose
“Has vuelto a tu usual tú.”
“Primero… La Reina de La Noche es la
madre de Wise, su nombre real es Kazuno-san.”
“Así que su nombre es Kazuno-san… Tengo
que saludarla apropiadamente la próxima vez que la vea.”
“Guarda eso para después de la pelea.
Por favor ahórrame la larga charla entre dos madres.”
“Es innecesario decirlo. Kazuno-san es
un jugador de prueba, y mientras adaptamos el juego, ella ha sido perseguida
por sus propios pasatiempos y deseos. Ella puede ser fácilmente clasificada
como una persona vergonzosa.”
“Guh… la vergüenza de mi familia…” *….
“¡Wi-Wise-san! ¡Por favor cálmate! ¡Vas
a evolucionar el algo extraño!”
La hija, que estaba a punto de
demonizarse como su madre, recupero algo de calma.
Entonces, Shirase dijo a ellos un
importante detalle.
Además, respecto a su estado. Su
profesión es un Sabio como Wise-san, y le fue dado un grimorio que puede usar
cada magia por el Privilegio de Primera vez. Como las espadas de Mamako-san,
ella también recibió el equipo oficial trampa para uso de solo madre.”
“Wise… tú también pasaste a través de
ese calvario.”
“¡Fue duro! ¡Aunque tengo que gastar SP
por motivo de aprender magia, mama no necesita eso! ¡Fue mama siempre la que
estaba activa en batallas, no tenía nada que hacer del todo!”
“Kazuno-san que había estado acumulando
una gran cantidad de SP parece haber gastado algo de puntos en aprender la
Cancelación de Casteo… Y esa es toda la explicación respecto a la capacidad de
la Reina.”
“¿Eh? No, ¿por favor espera un minuto?”
“Shirase-san, ¿puedo preguntar algo? La
defensa invencible de la Reina…”
“Esa habilidad, más que decir que no fue
dada a ella, no fue instalada en el juego en primer lugar.”
“¿Eh?… No fue instalada en primer
La Reina estaba usando una habilidad inadquirible.
Eso significa…
“… No me digas, cheat(trucos), ¿huh?”
“¿Chiito? Hey Maa-kun, ¿Qué es eso?”
“Ah, puesto simple, es como un tipo de
[Acto Injusto]. Sin embargo, dependiendo de la severidad, no es solo
simplemente siendo injusto.”
Fue claramente jugar sucio. Dañar el
juego podría ser un acto criminal que podría incluso dañar su vida.
Shirase asintió pronfundamente a las
palabras de Masato.
“Es exactamente como dices, Kazuno-san
esta probablemente usando algún tipo de herramienta de trucos. Después de
revisar los registros, he confirmado que algún programa externo ha sido enviado
a ella.”
“Enviando desde fuera, ¿dices?”
“Los detalles desde el historial de
adquisición son aún no claros, pero no podemos negar la posibilidad que fue
enviado unilateralmente. El mecanismo de la herramienta incluye invencibilidad,
hacer NPC actúe fuera de su configuración, tomar cuentas e incapacitar otros
pensamientos ajenos. Dando un amplio rango de usos, es fácil de notar de porque
los usuarios pueden ser adictos a esto inútilmente y continuar abusando… es
como una droga.”
“Es esa cosa donde una vez la usas,
serás adicta a ella hasta el final, huh…”
“Esa madre idiota… que demonios ella
hizo… ella solo tenía que hacer esto, de todas las cosas…”
“Eso es verdad. Eso no es algo
divertido. Usando herramientas de trucos está prohibido en primer lugar. Si por
alguna casualidad ella causa problemas para la operación, el lado
administrativo no vacilara en tomar acciones legales.”
“Quieres decir que su subsidio huh…”
“El gobierno es quien provee los fondos
para este juego. Esta planeado para ser desarrollado a nivel nacional, y las
preparaciones están ya bajo… si un retraso ocurre debido a este problema,
entonces dependiendo de la situación, no sería extraño si la compensación por
daño cueste billones.”
“Espera… m-mama no puede ser capaz de
pagar eso tanto…”
“Ella tendrá que pagar, incluso si no
paga. En ese aspecto, el estado legislativo no la dejara fácil en ella.”
“No puede ser… si eso pasa… que pasara
con mi mama…”
Las manos temblando de Wise vagaban sin
objetivo… y entraron en contacto con el brazo de Masato. Sus delgados dedos se
agarraron con firmeza en su brazo como eso. Como estar buscando por ayuda.
A pesar de decir cosas de ignorarla, en
su corazón, ella aún se preocupaba por su madre.
eso. Está bien. No te preocupes. Yo… nosotros estamos contigo.
Él fue incapaz de imitar gestos de
afecto como susurrar suavemente o poner su mano sobre la mano de Wise, pero
tenía la voluntad. La determinación de Masato estaba ya lista.
“Es verdad que esto será un asunto
grave, pero podemos aún arreglarlo, ¿cierto? Hay aún algo que puede hacerse,
Como insinuó, Shirase pensó por un
momento, y eligió las palabras para su respuesta.
“Esto es solo una medida extrema… si
fuéramos a destruir la computadora de Kazuno-san usando en el mundo real, el
asunto completo podría ser acabado. Eso sí estamos solo hablando del método.”
“Emplear tal método forzado
definitivamente traerá críticas. No terminara solo como eso.”
“Es justo como dices. Si este asunto es
expuesto, criticas podrían fluir al lado administrativo, que es el gobierno.
Eso podría entorpecer la operación… Y más que nada, en el caso donde la
computadora actúa como un medio para el full dive fuera a ser dañada, podría
ser incapaz de garantizar la seguridad del cuerpo de Kazuno-san.
El gobierno no quiere dañar a sus
ciudadanos. No podemos usar este método.”
“Entonces después de todo, no tenemos
opción sino hacer algo dentro del juego.”
“Eso es correcto… hacer algo sobre el
juego dentro del juego… porque de este incidente, usando los profundos lazos de
un padre e hijo y guiándolo a tocar una conclusión será la mejor salida. Si
pueden hacer eso, sería capaz de escribir un buen resumen de reporte luego.
“Entonces está decidido.”
Al final, podría probablemente depender
de Wise y su madre, pero podrían hacer que ellas puedan lograr eso. Para
pelear, y ganar. Ellos deben detener a la Reina después de ganar. Ellos tienen
que comenzar por ahí.
Consiguiendo una vista clara de su
objetivo, Masato miro a sus compañeros.
“Para Wise, ya sabemos que es lo que
quieres, ¿correcto?”
“¡Por supuesto! ¡Obviamente, voy a ir a
“Muy bien… Ya que Porta es una
“¡No! ¡Trabajare duro también! ¡Daré lo
mejor con mi habilidad!”
“Un, eso es cierto. Ya que Wise tuvo su
magia sellada y murió inmediatamente, Porta necesita preparar el objeto que uso
esa vez.”
“¡Hey, no digas eso con asumir que lo
hare de nuevo! ¡Trabajare duro para no volverme una molestia!”
“Por favor hazlo así… ¿Qué hay sobre
“Aunque mama siente que no está bien
interferir con los asuntos de otras familias, ya que se ha vuelto como esto,
mama no se restringirá en mediar. Mama tiene el más grande poder de fuego. Mama
mediara inmediatamente.”
“Esa es una buena escena, así que no lo
arruinare con un retroceso… Como tal, Shirase-san.”
a nosotros
, él transmitió tal intención con sus
ojos como miro directo a ella, mostrando su voluntad a pasar por el reto.
Shirase miro a aquellos retadores y
asintió profundamente.
“Entendido. Entonces, deja que esta
Shirase use el poder del secreto prohibido y los guie a todos a donde está la
Shirase miro directo hacia el profundo
bosque y agarrando ambas manos como en rezo.
¿Acaso conoce su escondite?
“Si. La Reina está actualmente oculta en
una Dimensión Externa, además encantada con su poder.”
“Dimensión Externa, y además encantada.”
“Poniéndolo en pocas palabras, podría
decirse que ella ha abierto una [Ventana Alterna] y está en el programa de
cambiar el código del sistema. He recibido una comunicación del Departamento
del Sistema.”
“Eso fue en verdad contundente.
Arruinaste el sentimiento de fantasía.”
Incluso si esto fuera un juego que no
podría funcionar con múltiples cuentas, por usar herramientas de trucos, podría
ser posible abrir múltiples pantallas de juego en la computadora y correrlas al
mismo tiempo.
Las cosas consumen tiempo como quest o
producción, originalmente requieren que el jugador elija una u otra, pero si
ambas fueran hechas al mismo tiempo, entonces el jugador podría conseguir ambos
resultados. Fuera una barbaridad.
Sin embargo, ese tipo de conducta podría
absolutamente no ser prohibida.
“Reina de La Noche… si vas a hacer algo
como eso, yo también no me restringiré… poder con poder, vamos a pagarte con mi
poder abrumador… conectado a la Dimensión Externa, ¡Te arrastrare fuera al
suelo del juicio!”
¡Y Shirase canto fuertemente!
”¡Activación Forzada! ¡Indisputada Magia
Máxima [Intervención・Administrativa]!”
“Uwa… Que magia definitiva descarada.”
Ella activo el gran poder que controla
el entero juego online [MMMMMORPG(temp.)].
El escenario de un denso bosque ante sus
ojos comenzó a distorsionarse… cuando la distorsión se detuvo un momento
después, el escenario regreso al normal, como si nada hubiera cambiado.
Sin embargo, ese no fue el caso. La
fragancia del perfume que solo Porta podía oler hasta ahora, se volvió más
fuerte antes que lo notaran. Eso fue indudablemente la presencia de la Reina…
“¡Flusso・di・Lava (Flujo
de Lava)!”
La voz de la Reina hizo eco, y el bosque
oscuro fue teñido de rojo en un instante. En frente de ellos, un vapor de magma
ardía y tragaba los árboles mientras se empujaba hacia ellos a la vez. Los
alrededores inmediatos se volvieron un mar de flamas.
Fue solo un efecto visual de lo mejor,
pero ellos no podían decir eso.
“¡Kuh, ella repentinamente apareció!…
¡Masato! ¡Es tu turno!”
“Hablando francamente, estoy a punto de
llorar, pero si no lo hago aquí, ¿¡cómo podría ser clamado como un héroe!?”
Masato salto delante sobre el vapor
escarchando y empujo su brazo izquierdo para desplegar su escudo defensivo. ¿Lo
hare con esto? ¡Tengo que defender contra esto, incluso si esto es imposible!
Él estaba bañado con enorme calor, pero previniendo que sus compañeros fueran
tragados por el magma.
“¡Lo detendré de alguna forma, pero a
este ritmo, voy a ser vaporizado vivo! ¡Mi HP esta siendo arrasado!”
“¡Entonces lo enfriare para ti! ¡Supra・La・Magia・Peru・Mirare… Vento・Neve(Ventisca)!
¡Además! ¡Ghiacco・Grumo(Alud)!”
Fue el Chainspell de Wise. La ventisca
enfurecida enfrió la temperatura de los alrededores, mientras los enormes
témpanos de hielo que cayeron solidificaron el magma. Parece ser posible
caminar en la superficie de la lava enfriada.
En frente de ellos, la figura de la
Reina sosteniendo su grimorio en su mano apareció, con ella de pie manteniendo
su compostura.
“¡Mama! ¡Estoy viniendo por ti, así que
quédate ahí!”
“¡Ah! ¡Oi Wise!”
Tan pronto como ella vio a la Reina,
Wise comenzó a correr, dirigiendo delante por si misma. Masato apuradamnete
persiguió tras ella.
En ese momento, un sonido cortando el
viento vino desde el lado. Algo tajo abajo en ellos.
“¿¡Qué!? ¿¡Es esto un monstruo!?”
Él esquivo por saltar atrás y cuando
reviso, resulto que había sido una rama de árbol.
Fue un monstruo árbol desde el lado… no,
no fue. Eran los árboles creciendo en los alrededores de ellos.
En los alrededores del equipo de Masato,
cada árbol comenzó a moverse horizontalmente, algunos árboles giraban alrededor
y balanceaban sus ramas, otros intentaban tomar un objetivo y caer sobre ellos,
ellos veían tales extraños movimientos.
“Esto… podría ser, ¿ella está
controlando objetos para ocuparnos? ¡Kuh, que problema! ¡Hay demasiados de
ellos, ya que uno de nuestros flancos está expuesto al bosque!”
“¡Deja esto a mama! ¡Sin importar
cuántos de ellos sean, mama atacara a todos ellos a la vez!”
“¡Estoy agradecido que tengamos un
ataque de todos los objetivos! ¡Entonces te dejo a cargo de este lado! ¡Voy a
ir tras de Wise! ¡Porta, quédate cercas de mama!”
“¡S-Si! ¡Estaré al lado de Mama-san!”
“Shirase-san esta… huh…?”
Shirase, que estaba supuestamente al
lado de ellos, no estaba en ningún lado a la vista… aah, había un ataúd bajo
los árboles caídos. “¡Iré a resucitarla!” “Un. Te lo encargo.” Entonces él dejo
eso a Porta.
La Reina activo un vórtice oscuro
después de liberar su primera ola de ataque, y rápidamente entro. Wise fue tras
esa figura y salto sin vacilar.
“¡Geez! ¡No es que no entienda tus
sentimientos, pero no solo vayas repentinamente dentro por ti misma!”
Pateando un árbol ante él, salto sobre
otro árbol caído, Masato rápidamente salto dentro del vórtice oscuro.
Él corrió a través del flujo estancado
que creo el vórtice arremolinado. Continúo corriendo.
Después de llegar a un espacio pequeño
adelante, Masato se detuvo.
“… ¿Qué con este lugar?”
Lo que vio fue un espacio cubico. Había
un total de seis lados. Las paredes y techo eran como monitores sin marco, con listas
de códigos plasmadas en ellos. Era tal habitación como digital. Sin embargo, no
tenía el momento para mirar alrededor sin cuidado.
Dentro de ese espacio estaban Wise y la
Reina. Ellas mantenían una distancia mientras se confrontaban una a la otra. Ambas
tenían sus grimorios equipados, estaban a un solo detonante lejos desde una
Masato apuradamente corrió al lado de
Wise, y preparo su Espada Sagrada Firmament.
“¡Masato, llegas tarde!”
“¡Tú eres la que corrió fuera
primero!… Así que, ¿Cuál es la situación?”
“El escenario ‘Totalmente no escucho’.”
La Reina ligeramente resopló como Wise
estaba mirándola a ella, entonces ella miro a Masato cuidadosamente.
Parecía como si estuviera intentando de
medir su valor.
“Hmph… un chico plano. No guapo o macho.
¿Es ese tú novio?”
“¡Mal! ¡Más bien, no quiero que me digas
sobre tus intereses en hombres! ¡Eso no es lo que trato de decir!… ¡Es
momento para responder mis preguntas ¿¡Qué con este lugar!? ¡Explícate!!”
“Haa… Gya gya gya gya así de ruidosa… Honestamente
hablando, no lo sé. No sé nada.”
“¿¡Haa!? ¿¡Que con eso!? ¡Deja de
pretender que no sabes!”
“Pero esa es la verdad. No sé qué es
este lugar. Recibí un regalo en mi almacén de objetos desde una persona
desconocida. Después de abrirlo, esta localización apareció… Hablando de que
se, podría ser solo ser que [Si hago un deseo aquí, me será otorgado].”
“Q-que dices con eso…”
“Es exactamente lo que piensas que
significa. Si digo que quiero un asombroso hombre para volverse mío, me enseña
el método para libremente controlarlo. Si le digo que quiero volverme más
fuerte, me dará un velo que hace los ataques incapaces de golpearme. Si digo
que quiero derrotar enemigos sin usar magia, puedo terminar enemigos con un
movimiento de mi dedo o un balanceo de mi brazo. Es así como es.”
“E-espera un momento… No entiendo que
quieres decir…”
“No, espera. Eso es…?”
Este lugar es exactamente la herramienta
trampa que la Reina ha estado usando… con el programa ¿huh?
De acuerdo a la historia que escucho de
la Reina, ella no fue la que opera esta herramienta…
“Alguien más está operando esto para
acomodarse a las demandas de la Reina… eso es lo que activa los efectos…?”
En eso caso, quien…
Él tenía que pensar en eso luego. La
Reina hizo su movimiento.
“He respondido tus preguntas. Entonces
espero que puedan retirarse… Connielio, Orekkio, Tiffone. Bienvenidos, ustedes
Respondiendo su llamada, tres
existencias aparecieron repentinamente.
Un conejo de pelaje azul. Una mariposa
con alas en forma de orejas. Un torbellino con joyas girando.
La Reina estaba brillando con felicidad
después de llamar al trio, como si ella hubiera obtenido todo en el mundo.
“También obtuve estos niños en este
lugar. Ellos son muy obedientes. Siempre y cuando este lugar exista, todos mis
deseos serán cumplidos. De pie en la cima de este mundo será fácil. Controlar
todo será también fácil. Y entonces… controlando este mundo, el real, también
será posible.”
“Uwa, qué diablos están diciendo. Estas
“Es la verdad. Intente preguntando eso y
su respuesta ‘es posible’ para mi. Los administrativos de este juego son del
Gabinete Oficial, así que solo necesito hackear dentro de la red y hacer esto y
eso… bueno, de todas formas, es posible.”
El Gabinete Oficial. Es innecesario
decir que era el centro de Japón. El núcleo de la nación.
“Si hago un deseo ‘Quiero los documentos
super secretos de la nación’ y obtenerlos, me pregunto cuanto tanto la gente
pagara por esto… Si puedo libremente controlar el sistema de la Institución
Pública, que podría hacer la gente para evitar el daño…”
“¡Hey, detente! ¿¡No es eso demasiado
para una broma!? ¡Tú ya estas caminando en hielo delgado! ¡Ya es momento de
“No tengo la intención de bromear. Eso
puede pasar, no, eso es lo que voy a hacer desde ahora. Muy bien, lo he
decidido. Me volveré la gobernante. Todo será de acuerdo a mi voluntad… Es por
esa razón, dejen de molestarme más que esto. Desaparezcan de mi vista. Me
siento enferma solo por mirarlos.”
“¿¡Hey, esa no es forma de hablarle a tu
hija biológica!?”
“Yo lo diré de todas formas. Porque eres
solo una existencia que arruina mi humor.”
Mirando a Wise como si ella fuera alguna
molestia seria, la Reina murmuro.
“Incluso si dices esto, estoy siendo
seria. Seriamente pensé sobre la reconciliación entre madre e hija… sin
embargo, no importa eso ahora.”
“Los niños son hirientes. Ellos actúan
engreídos todo el tiempo, siempre siendo molestos, una existencia que despoja a
sus padres de su paz y libertad… Es por eso, Genya…”
“¡E-espera! ¡Espera! Una vez más…!”
“Está bien ya. No necesito a alguien
como tú. Apúrate y desaparece de mi vista.”
La Reina lentamente apunta a Wise. Al
mismo tiempo, la mariposa en forma de oreja empujo delante con velocidad que
los ojos no pueden seguir para golpear fuera a Wise sin más. El grito no fue ni
largo. Ella fue empujada fuera al otro lado del vórtice oscuro.
Y una incontrolable ira creció en el
corazón de Masato.
Fue una ira que no necesitaba resistir.
Su fuerza se externo en la mano que sostenía la espada.
“Hey, tú… ¿Por qué eres así? ¿No eres
aún una madre?”
“¿Oh, un sermón? Espero que puedas
parar. Al final, ¿no eres lo mismo como esa niña? No estas tratando a tus
padres como un padre, diciendo cosas egoístas, ¿haciendo lo que quieras?”
Aunque las palabras paralizaron un poco.
Aquellas palabras espinosas espléndidamente lo golpearon.
“… Reconozco ese punto.”
“Ufufu. ¿Es eso así? Todos los niños son
“Aah, eso es cierto… Cuando pensé que
transferirme en un juego había visto los sueños hechos realidad, mama también
vino conmigo. Como no me gusto, también había desbordado de enojo.”
Como resultado de eso, hizo a Mamako
“Aunque es bueno que comenzamos una
aventura juntos, no me gusta lo que mama estaba diciendo y haciendo, así que la
regañe. Ventile mi enojo de un solo lado.”
Sin embargo.
“Pero… mi mama no dijo las cosas que tú
estás diciendo.”
Masato recordó. La apariencia de Mamako
de ella cubierta en lágrimas.
No importa lo egoísta que hable un niño,
como ella tanto fue herida, ella podría perdonarle, y encarar con la misma
sonrisa como siempre, ese tipo de madre.
Una madre era una persona que podría
perdonar. Una persona que podría aceptar.
Masato pensó así.
“Estoy bien al tanto de lo egoísta que
somos… Sin embargo, ¿no puedes aceptar esa parte de un niño?”
“No es solo esa ocasión que los padres
tienen problemas.”
“Incluso así, acepta a tu hija. Esa
tonta quiere una reconciliación entre tú y ella…”
“Haa… no puedo hablar contigo.”
Ella deja salir un suspiro mofándose,
como si ya se ha rendido en el fondo de su corazón.
“Es por eso que odio a los niños. Ellos
solo piensan en sus propias circunstancias. ¿Acaso piensas que puedo tener una
conversación decente con insectos?”
“Yo también entiendo que lo que digo es
irrazonable. Pero no hay otra manera de decir esto.”
“No quiero escucharlo. No soy como un
dios. Aquí, justo como vez, soy un demonio. Algo como perdonar a un niño
“Tú definitivamente tienes que. Al
final, a pesar de lo que digas, eres una madre… Si no puedes verlo no importa
“¿Qué vas a hacer?”
“Te arrancare esa apariencia demoníaca y
te recordare. Incluso si tengo que agotar toda mi fuerza.”
Él apunta la punta de su espada cubierta
en espíritu de lucha.
“Oh mí, ¿estas intentando desnudarme?
¡Ufufu, ahahahaha! Muy bien, por favor hazlo… Si es que puedes, claro está.”
La Reina distorsiono las esquinas de su
boca obscenamente, el momento hasta que la magia fluyo fuera desde su delgado y
sonrientes labios fue… 0 segundos.
Batalla abierta instantánea.
“Bomba・Sfera. (Bola
de Explosión)”
“¡Esa magia es una explosión de área
pequeña! ¡Entonces daré mi mejor para tomar mi distancia y evadirlo!”
“¡Esa es un amplio rango, si no puedo
evadirlo, lo resistiré con mi defensa!”
Impacto caliente, estimulación fría,
lluvia con continuos ataques mágicos liberados en ritmo, Masato repentinamente
entro a una batalla defensiva.
Sin embargo, ciertamente evito un golpe
limpio. Él no tomo daño innecesario.
“Estas lidiando con esto con buena
“¡Había hecho preparaciones! ¡En
cualquier caso, estas usando la misma magia como tú hija! ¡Madre e hija tienen
similares patrones de ataque después de todo!”
“Hmph. Tales palabras molestas.”
La Reina mostró malestar y balanceo su
brazo ampliamente. Ella libero una onda de choque diferente de magia.
“¡Ese ataque problemático vino huh!
Ese ataque no puede ser visto, así que
no puede ser evadido. Masato inmediatamente eligio la defensa.
Él no pudo tomar la presión completo
arrojada hacia su camino, su cuerpo floto fuera del suelo…
Desde el piso inorgánico, al suelo con
el olor de tierra y césped. Masato rodo desde el vórtice oscuro y detuvo su
cuerpo golpeando contra algo duro.
“¿¡Guh!?… Tsu… q-que es esto…”
El escenario alrededor cambio. Se
suponía que fuera un denso bosque, pero los árboles que crecían en los
alrededores se fueron, cambiando a un lugar de espacio abierto. Parece que hay
un ataúd que fue atrapado y abrazado por una restante rama de árbol… esa es Wise huh. Porta estaba haciendo
lo mejor para manejarlo.
Y lo que Masato golpeo fue una montaña
de madera, que fue creada de los arboles apilados.

¡Maa-kun!… ¿¡Estás ahí!?…
Pudo débilmente escuchar la voz de
Mamako desde dentro.
“¿Mama?… ¿¡No me digas que estas
atrapada dentro!?”
Masato balanceo su Firmament para cortar
la montaña de madera ante sus ojos. Un golpe con toda su fuerza.
Sin embargo, la estructura fue
totalmente ilesa. No habia incluso un arañazo.
“Oi, ¿¡porque eso!? ¡El edificio del Gremio
de Aventureros había sido destruido! Los objetos también deberían ser capaces
de ser destruidos por ataques normales…!”
“Si, eso es cierto. Ellos pudieron ser
destruidos debido a que fue un bug. Hasta ahora… Pero parece que el parche fue
completado, ellos no pueden ser destruidos más. Tú mama no puede salir.
Sellando ese problemático poder de ataque fue un éxito. ¡Ufufu, ahahahahaha!”
La Reina lentamente camino fuera del
vórtice oscuro, estaba carcajeando con gran alegría.
“Intentando tan desesperadamente,
rescatarla… ¿qué? ¿Podría ser que quieres que tu mama te ayude? Incluso aunque
usualmente la tratas como una molestia, ¿aún quieres ayudarla solo cuando estas
en problemas?”
“¡No es eso! ¡Solo quiero
rescatarla!¡Ver a tu propia madre encerrada como esto, cualquier niño podría
normalmente ayudarle!”
“Dices algo como eso, al final el
resultado es que solo convenientemente tomas su fuerza. Ah, no es bueno no es
bueno. Los niños son egoístas después de todo. Quiero parar ya. Tú mama también
piensa así.”
“¡Mi mama es diferente a tí!”
“Ella no es diferente. Porque ambas
somos madres. Es por eso que te enseñare como se siente tú mama… Un niño que
intenta usar a su madre por conveniencia es…”
La Reina elevo su mano, la magia fue
inmediatamente activada.
(Luz de Castigo Divino)”
Con su voz en eco, un trueno cayó desde
el cielo y perforo a través de Masato. Todo paso casi instantáneamente.
El escudo defensivo de Masato en su mano
izquierda fue desplegado y bloqueo el golpe.
Sin embargo, tomo un gran daño.
“¡Tsk!… Estp es, bastante… efectivo.”
Aunque él no quería, sus rodillas
cedieron y toco el suelo.
“¿Cómo está? ¿Has saboreado los
sentimientos de mama? Mama está enojada con todo el mundo. Esto es el martillo
de hierro de ira. ¡Ufufu!”
“Por supuesto, hay probablemente ira
dentro, pero… este tipo de…”
“No es solo ira… Malestar, depresión,
lamentos… todas las madres en el mundo sienten inconformes con sus niños. Ellos
son una carga. Ellos son una molestia. Nosotras deseamos que puedan
“Eso es…!”
“Para los padres son simplemente
cadenas. Solo cosas que inhiben nuestra libertad. Eso es todo. ¡Ufufufufu,
ahahahahahahaha!” *
La Reina elevo una carcajeada irritada.
Masato quería refutar inmediatamente, sin embargo.
En eso momento, sintió todo de repente.
El suelo estaba ligeramente temblando.
Este temblor fue el tipo que sintió
varias veces antes… eso es correcto, no había equivocación.
La Madre Tierra estaba temblando en
respuesta la llamada de los pensamientos de cierta madre.
Masato aconsejo a la Reina por
“… Tú sabes, ahora es la única
oportunidad si quieres cambiar u manera de pensar.”
“¿Hah? ¿Cuántas veces te lo he dicho ya?
Que he dicho todos los hechos. Hechos sobre madres. No hay necesidad de
“Es eso así… entonces te has hecho una
resolución, ¿cierto?”
Masato llamo con todo su ser.
“¡Una madre que es diferente a ti está
aquí! ¿¡No es eso correcto!? Hey… ¡mama!”
Justo después, el suelo temblo.
Sin decir de pie, el suelo estaba
temblando tan violentamente que uno no podía apoyar su cuerpo incluso en una
postura de arrastrarse.
Desde la pila de montaña de madera, una
enorme grieta corrió a través del suelo. Pronto, una enorme cantidad de agua
desbordo fuera de la grieta con un sonido chirriante, empujando los árboles
lejos con el flujo.
Después que todo fue limpiado, la figura
de Mamako sosteniendo las espadas gemelas, La Espada Sagrada de la Madre Tierra
y la Espada Sagrada de la Madre Mar, estaba de pie ahí.
Espadas en manos, Mamako estaba ahí con
su usual sonríe fuera de la vista.
“C-como puede eso ser… ¿Por qué?…
Aunque no debería ser capaz de romperlo… ¡Incluso aunque no deberías ser capaz
de salir!”
A pesar de lo que la Reina decía, la
figura fuera fue la verdad.
Mamako miro directo a la Reina como
lentamente caminaba hacia ella.
“Nunca he olvidado un solo momento… el
momento cuando mi niño nació. Ese momento cuando seriamente pensé que podría
morir por este niño. El día cuando mi niño rio por primera vez, el día cuando
me llamo mama por primera vez, yo nunca lo olvidare. Porque soy una madre.”*
Moviéndose pasó a paso a la vez, como si
ella saboreara sus palabras línea por línea.
“Como podría existir una persona que
olvido esa gran felicidad… no hay nada comparable a eso, ni una sola cosa. Es
solo lo que tenemos entre nosotros, la irremplazable relación padre e hijo.
Porque estás haciendo luz de esto… tuve momentos difíciles entendiendo. Me
siento enojada. Y también me siento triste.”
Mirándola con una ligera pena, Mamako
elevo su rostro.
[Kiel: De nuevo señale las frases con *]
“Sin embargo, tengo fe. Si eres también
una madre, debes ser capaz de recordar… no, hare que recuerdes. Por el bien de
Wise-chan que es tu niña, a toda costa.”
“Hmph. Aunque es una rara oportunidad,
me gustaría rechazarlo. He perdido todo el interés ya… no necesito algo como un
niño. Es suficiente para mí estar en este mundo sola. Porque tengo poder. El
poder que no dejara a nadie molestarme, hacer que todo pase de acuerdo a mi
voluntad es…”
“En ese caso, debo borrar ese pequeño
poder del que te jactas tan fuerte. Hacer eso hará probablemente que lo notes.”
“Qué estupidez. ¿Acaso piensas que
pudees hacerlo?”
“Si, yo puedo. Porque el hijo de quien
estoy tan orgullosa está aquí… ¿Cierto, Maa-kun?”
El rostro de Mamako que repentinamente
volteo después de llamarlo… tenía su apariencia usual. Era una sonrisa que era
tan juvenil que no parecía la de una madre, aunque sabía que era
definitivamente su madre.
cielo… como el hijo en que ella se enorgullece, no puedo mostrar mi lado
Masato irrazonablemente levanto su
cuerpo herido con todo su ser. Saco su pecho, elevo su espada y corrió al lado
de Mamako sin preocuparse por las heridas cubriendo su cuerpo entero.
Y dijo una cosa, sentía que tenía que
decirla ahora no importa que.
“Por ser un hijo que siempre habla
egoístamente, lo siento. Como tal… gracias. Estoy agradecido que seas mi mama.”
“Si. De nada.”
Fue el enfrentamiento final. El dúo de
madre e hijo peleando lado a lado uno del otro, enfrentando al enemigo que
tenían que derrotar.
La Reina estaba en completa alerta,
tomando una postura con su grimorio en mano. Fue una señal que un ataque mágico
iba a venir pronto, sin embargo… antes de eso.
“¡Masato-san! ¡Toma esto!”
Él fue repentinamente llamado por
detrás. Como giro alrededor, Porta arrojo una pequeña gema hacia él.
“¡Por favor arroja esto al aire! ¡Eso la
Justo como dijo, él la atrapo y arrojo
la gema al aire.
Desde la gema brillando, un extraño
temblor que sonaba como una vibración fue liberado.
El temblor cayó a aquellos de pie en el
campo de batalla.
Masato no fue afectado. Mamako fue
también inafectada. Porta, como con Wise que estaba actualmente en el ataúd,
fueron también inafectadas.
La magia de la Reina fue sellada.
“Qu… qué demonios… eso es, imposible…”
“¡Incluso la manera de quejarse es
similar para madre e hija!… ¡Porta, buen trabajo! ¡Tú eres el MVP!”
“¡Estas halagándome! ¡Estoy agradecida
que ha sido útil!”
“¡Entonces, vamos mama! ¡Vamos a
enseñarle lo que significa ser padre e hijo!”
“¡Si! ¡Vamos!”
Masato corrió con su cuerpo que debería
tener problemas por esta de pie. No podía dejar esta oportunidad irse. Ganando
la iniciativa, abrumo a ella en una ida.
El ataque de Masato. Piso dentro del
espacio justo frente la Reina que tenía su magia sellada, balanceando Firmament
abajo. Una pieza del Velo de Oscuridad fue roto.
“¡Kuh!… Algo como tener mi magia
sellada, lo disipare inmediatamente…!”
“No te dejare. ¡Haa!”
Siguiendo después de Masato, fue el
ataque de Mamako. Ella balanceo Terra di Madre en ese punto. Todas las hojas de
piedra que aparecieron desde el cielo atacaron a la Reina. El segundo Velo de
Oscuridad fue quebrado.
Estaba aún el ataque de Mamako, pero en
el medio de eso la Reina en pánico llamo por Mamako.
“¡E-espera un minuto! Tú de ahí, dices
que te llamas Mamako-san, ¿¡cierto!? Eres la mama de ese chico, ¿¡cierto!?”
“¡Eso es correcto! ¡Soy la mama de
Maa-kun! ¿¡Qué hay sobre eso!?”
“Entonces tal vez pienses sobre esto
también, ¿¡cierto!? Siendo arrastrada alrededor por las palabras egoístas de tu
niño, ¿¡no te has sentido terrible hasta ahora!? ¿¡Estoy mal!?”
“Eso es…”
La mano atacando de Mamako se alentó
todo de repente. Masato estaba también interesado en que tipo de respuesta
podría dar, así que se detuvo sin pensar.
El corazón de la madre conocida como
Mamako no tambaleo un poco.
“Vamos a ver. Me hace sentir triste.
También siento dificultades… Sin embargo, lo entiendo. Un niño es algo como
“Algo como eso, dices… no puedo simplemente
aceptar ese tipo de…!”
“Creo que eso que dices es también algo
de verdad. También tengo aquellos sentimientos que mencionas. Los padres son
también gente. Estar calmados a pesar de lo que otra gente dice de ti, no ser
heridos, perdonar todo, no somos tales tipos de dioses.”
“¡E-eso es cierto! En ese caso…!”
“Pero entonces pensé… Entrando en
contacto con mi niño, pensé sobre algo… eso es algo que solo puede ser hecho
cuando el niño es cercano a ti. Todo eso es un tesoro que puede ser solo
obtenido aquí y ahora, y no puedo ser por padres solos… ¡Es por esa razón!”
Mamako bajo Altra. Balas de agua fueron
disparadas desde el vapor de agua creado, sin piedad perforando el cuerpo de la
Reina. “¿¡Guh!?” Ella fue dañada.
“Es por esa razón, aceptare todo lo de
mi niño. Aceptarlo todo, abrazar todo. Nunca lo abandonare no importa que
Ella fue bañada en una tormenta furiosa
de ataques y palabras con determinación.
La Reina escupió con su rostro rojo.
“¡N-No te hagas la tonta conmigo! ¡No
reconoceré eso! ¡Eso son solo ideales! ¡La realidad no es así!… ¡La que esta
correcta soy yo! ¡Yo soy quien está en lo correcto! ¡Los niños son solo
egoístas, malcriados y molestos!”
Ante la Reina, las criaturas el conejo
azul, la mariposa en forma de oreja y torbellino de joyas cortaron dentro. La
Reina los llamo para ser su escudo.
Sin embargo, fue todo para nada. Fue el
ataque de Masato.
“¡Deja de huir todo el tiempo! ¡Tú niña
ha estado desesperadamente estirando su mano para llegar a tí! ¡Entiende eso de
una vez!”
La ola tajada corto abajo al conejo azul
ágil que había saltado, un cayo.
Mamako continúo.
“¡Conozco bien el dolor de tus
sentimientos! ¡Pero aceptarlos es lo que solo tú como un padre puede hacer!
¡Así que deja de huir! ¡Enfrenta a tu niña propiamente!”
El ataque de Mamako. Las hojas de piedra
desplegadas por Terra di Madre completamente perforaron al torbellino de joyas.
Mamako ataco de nuevo. Las balas de agua
de Altra fueron disparadas en masa. Sin embargo, la mariposa en forma de oreja
voló con una tremenda velocidad y esquivo todos los ataques…
En ese momento.
(Explosión de Flamas)”
Flamas repentinamente erupcionaron en el
aire, quemando a la mariposa en forma de oreja hasta achicharrar.
“¡Además! ¡Indebolito! (Debilitar)”
La magia seguida después debilito la
defensa de la Reina.
La que libero el Chainspell fue Wise.
Wise había derrotado el último enemigo y también exitosamente debilito a la
Reina después de ser revivida por el objeto de Porta.
“¡Mama! ¡Termina esto ya! ¡Toma un buen
golpe, enfría tu cabeza, entonces propiamente habla conmigo después de eso!…
¡No importa que fue dicho, solo no puedo en verdad odiar a mama después de
todo! ¡Porque aún soy la niña de mama!”
“Genya… tú…”
“¡Ahora Masato, Mamako-san! ¡No hay
necesidad de ser considerados, háganlo!”
“¡N-no te dejare!… ¡Ven!”
Respondiendo la llamada de la Reina, el
vórtice oscuro se movió. Distorsionado en forma de dos grandes alas, encajando
perfectamente en la espalda de la Reina. Y ella voló. Alto en el cielo. Ella
probablemente pensó que los ataques no llegarían a ella en el cielo.
Sin embargo, eso es demasiado optimista.
Más bien, fue conveniente.
“¡Esto significa que es el turno de
Maa-kun! ¡Ahora, por favor!”
“¡Aah! ¡Enemigos en el cielo, déjenmelos
a miiiiii!”
La Espada Sagrada con especialización
anti-aéreas elevaron un rugido. La onda de tajo liberada corto una de las alas.
La demonio de un ala cayó desde el
cielo. Sobre eso.
“¡Mama! ¡Termínala!”
“¡Todo el poder de mama!… ¡Recuerda
que tú también eres una madre!”
Los ataques consecutivos de Mamako.
Hojas de piedra y balas de agua se dispararon al mismo tiempo.
Los ataques que convergieron con sus
deseos de todo corazón golpearon a su objetivo. El cuerpo de la Reina fue
completamente perforada, penetrada a través de su abdomen.
Esto fue decidido.
“Guh… c-como puede eso… yo, perdí…?”
La Reina derrotada cayó hacia el suelo.
Sus ojos en blanco se abrieron, presionando débilmente su estómago herido.
Sin embargo, antes de derrumbarse en el
suelo, su velocidad de caída se alentó.
La Reina fue atrapada.
“Eh… Genya…?”
Fue su hija la que atrapo por abrazarla.
Abrazando a su madre desde atrás, presionando su cabeza firmemente contra su
espalda, ella no dijo nada y solo continúo abrazando.
Con la Reina ligeramente acariciando la
mano de su hija, una gota de lágrimas cayó.
Ellos gentilmente mirando a esa escena
“Mama, gracias por el trabajo duro.”
“Si. Gracias por tu trabajo duro
Intentando no interrumpir a las dos,
Masato y Mamako intercambio en silencio high five (dame esos cinco). “U-Umm, yo
también…” “Oops, no es como me olvide de ti.” “Porta-chan también, gracias por
tu trabajo duro” Una vez más, los tres hicieron un high five.

Con eso, la cortina de la batalla fue finalmente

Okaa-san Capitulo 5 (Parte 1)

Capitulo 5: Un niño es un niño y un padre es solo un padre, hay varios problemas al ser humanos, pero hacer algo sobre ello es lo que se trata de ser un par de padre e hijo.
Masato salió fuera de las aguas termales
y se dirigió hacia el cuarto de vestirse.
Justo ahí, probablemente preparado por
el jefe de la villa, una peligrosa, aunque atractiva cosa fue preparada.
“… Estos dicen, leche Maman…!?”
detente. No lo malentiendas.
Lo que fue preparado
fue el clásico trato tomado después de salir del baño, algo de leche(en una
botella) bien fría. Fue hecha de leche de vaca producida en la villa Maman, de
ahí el nombre.
quieren que beba leche de Maman?
“¡Kuh! ¡Esto es diferente! ¡No es como
eso! ¡Es más, es para crecer más alto en el futuro!”
Masato puso una mano en su cintura y
bebió la leche en una idea. Puha.
En el mientras tanto.
“Masato, estas ahí, ¿cierto? ¿Puedes
venir un momento?”
Una voz le llamo desde el otro lado de
la puerta del cuarto de cambiador. Fue la voz de Wise.
“O-Ou… si estoy aquí pero… ¿no me digas
que vas a castigarme ahora? Si es así, entonces al menos dame algo de tiempo
para ponerme mis ropas. Ser arrojado completamente desnudo es en verdad
“¿Por qué los honoríficos? Más bien, no
voy a castigarte. Solo tenía algo que hablar contigo.”
Fue simplemente hablando, pero él había también imaginado siendo enviado a volar justo después de verse uno al otro.
Masato decidió vestir sus ropas primero de todos modos. Se puso los
calzoncillos de osito humildemente hechos por Porta, entonces una camisa.
Como Masato estaba poniéndose sus ropas,
Wise comenzó a hablar con extrañas palabras elegidas.
“Ya vez… Voy a salir fuera por un rato,
o como…”
“¿Hah? Salir dices, ¿A dónde?”
“Donde… Solo voy a dar un paseo en el
bosque cercano, algo como eso, tal tipo de sentimiento, o como ves…”
“Oi oi, vamos a ir a entrar a pelea con el jefe justo después de esto. Incluso así, pasear, y en el bosque también… ya
está bastante oscuro, ¿no es peligroso? Los monstruos también comenzaron a
aparecer, creo que es demasiado peligroso para ti salir sola.”
“Ah, un, eso es verdad, pero… ah… en ese
caso, ¿Masato quieres ir conmigo?”
“¿Haa? ¿Por qué debo ir también?”
Él la cuestiono sin pensarlo.
Wise no respondió inmediatamente, le
tomo tiempo pensar algunas cosas, entonces dijo distraídamente.
“… No importa, después de todo. Voy a
salir sola entonces.”
“¿Hah? Oi, ¿Qué con eso? Estas actuando
extraña… ¿huh?”
Él rápidamente termino de cambiarse y
abrió la puerta del cambiador, pero su figura ya se fue.
Como miro hacia la dirección del bosque,
pudo ver una figura roja desvaneciéndose en la oscuridad. Fue probablemente
Wise, que estaba entrando al bosque. Ella
en verdad intenta tomar una caminata en ese lugar huh…
encima de eso, ella
parece moverse hacia en la dirección sin incluso un solo rastro de animal.
“Ella luce extraña a pesar… si la
persigo ahora… ¡ahora no es momento para pensar sobre cosas como esta! ¡Geez!”
Masato tomo la Espada Sagrada del Cielo
Firmament que fue apoyada contra la pared, y corrió fuera del cambiador.
Sin embargo, aunque ir tras ella después
fue la elección correcta, él tal vez había sido demasiado descuidado.
“Maldición… Debería al menos traído algo
de fuente de luz… que fallo…”
Él solo corrió dentro del bosque que era
conocido por hacer que la gente se pierda, además, era durante el momento sin
algún rayo de luz y no trajo algún equipamiento. No estaba mal decir que esta
acción era igual al suicidio. Los buenos niños no deben imitar esto.
Se movía alrededor sin saber izquierda o
derecha, tampoco sabía que era lo que pisaba. Masato estaba avanzando con pobre
visibilidad. “¿¡Ugh!?” Tropezando, “¿¡Nuoo!?” Incluso su rostro corrió entre
telarañas, continuo buscando por Wise.
“Esa tonta probablemente esta también
perdida… y conmigo perdiéndome también, no terminara hasta que encuentre lo que
estoy buscando… por favor ahórrame por algo como esto… ¡oi, Wise! ¿¡No está
aquí!? Estas aquí, ¿¡cierto!? ¡Más importante, por favor quédate donde estas!”
Él llamo fuera de los arbustos,
levantando un árbol caído y revisando debajo “¿¡Oh, una horda de escarabajos
estiércol!?” Algo como eso, ella seguramente no podía estar debajo. Él busco y
busco, pero no pudo verla a ella. Solo el reloj continuaba avanzando.
Masato estaba perdido, él miraba al
cielo sin objetivo. Lo que vio en las brechas entre los árboles y las ramas fue
el cielo claro de la noche con una luna flotando en este…
Él vio una sombra balanceándose.
“¿Nn? ¡Hay algo por encima! Un monstruo
huh… espera… oi.”
Lo que vio encima fue la suela de un
zapato. Era la suela de una bota que recordaba haber visto en algún lugar.
Aterrizo sin un sonido, pisando el rostro de Masato como si fuera parte del
camino, y lo empujo al suelo justo como eso.
Había solo una persona que podría hacer
algo como esto.
“Haa… ¿Qué quieres? ¿Podría ser que esto
es el castigo por esa cosa de antes? ¿No ibas a ir con el plan de no castigar?”
“Esto no es un castigo. Esto es
simplemente aterrizar. Tu tienes la culpa por estar parado en mi punto de
“Esta chiquilla…”
Fue Wise quien aterrizo en el rostro de
Masato. Y ya ella había aterrizado en su rostro.
“… Mañana es día rosa, huh” “¿Acaso
dijiste algo?” “No, nada en realidad” La ropa interior para el uso del día
siguiente fue expuesta abiertamente, mirándole con asombro.
“¿Así que? ¿Qué estás haciendo aquí?”
“Esa es mi línea. Que estás tú… hm…?”
Como hablo a medias, Masato
repentinamente lo noto.
Las palabras que Shirase susurro a Wise,
el problema en la villa Maman, y la actitud de Wise después de escuchar sobre
esto, esta situación entera… ese tal vez había sido el caso, había varias cosas
más sugiriendo esa hipótesis. Para Masato, siento que esto era la respuesta
Él solo pregunto en caso.
“Hey, Wise. Tal vez he entendido la
historia completa, pero… cuál es tu relación con esa Reina, ¿o podría ser mejor
si no pregunto por ahora?”
“Eso es verdad. Pienso que es mejor si
no preguntas. Esa es la manera más fácil para que pelees.”
“Creo que no hace mucha diferencia en
ese aspecto…”
“¿Entonces qué? ¿Quieres que diga por mí
misma que quien amenazo a la villa y demando una ofrenda de un hombre musculoso
para que ella pueda jugar alrededor con él es mi ‘eso’? ¿Incluso aunque ya
siento como vomitara sangre? ¿Incluso aunque estoy a punto de llorar lágrimas
de sangre?”
Wise comenzó a mirarlo con sus ojos
inyectados de sangre, ampliamente abiertos. No había duda que la atmosfera era
de alguna forma diferente de la expresión de gratitud, pero bueno, esta no es una mala atmosfera, Masato acepto esa
“Entonces eso significa, vas a ir en
secreto a hacer contacto y de alguna forma persuadirla. ¿Está bien tomarlo como
“Eso es correcto. No puedo en verdad
dejarlo solo después de todo. No estoy relacionada tampoco.”
“Sin embargo, cuando tomaste la
decisión, estabas un poco insegura, así que me invitaste a venir contigo como
un apoyo mental.”
“Espera, ¡eso no es cierto! ¡En verdad
no intentaba venir contigo porque me sentía insegura, totalmente no tenía tales
pensamientos! ¡Totalmente no pensaba sobre eso! ¡Tú idiota, estando lleno de
confianza! Voy a lanzar un Chainspell de magia de muerte instantánea en ti,
¿¡escuchaste!? ”
Wise negó con un rostro sonrojado tan
duro, que él pudo notarlo en la oscuridad, pero bueno, ya que la persona en sí
lo negaba, ¿entonces debería solo dejarlo como eso?
“¡No es como eso, no es como eso! Solo
significa que, como una forma de seguro, traerte conmigo, eso es todo.”
“Como una forma de seguro…”
“¡Es en caso que mis palabras no lleguen
a ella! ¡Es posible que ella atacara con todo de repente! ¡Ella es ese tipo de
persona!… Si una oportunidad en un millón termina en una batalla, tres
ataques consecutivos son necesarios para dañar a la Reina. El ataque combo
entre nosotros dos es necesario. Haciendo que rompa a través de su defensa
invencible y dañarla.”
“Ya veo… eso es donde y vengo dentro con
este accesorio usado para combo.”
“Si. Esto.”
Los dos sacan sus  Anillos Aderire de sus bolsillos, y Wise se
lo puso en su dedo anillo derecho. “Apúrate, tú también.” “O-Ou…” Masato siguió
poniéndoselo por el momento. No había un significado más profundo en esta
Con eso, Masato repentinamente noto
“Si estamos considerando un escenario de
pelea, ¿no sería necesario el poder de fuego de mama? Llamarla a venir con
nosotros solo en caso…”
“No. Detén ese pensamiento. Por favor,
vamos a ir sin pedirle a Mamako-san ir con nosotros.”
“¿Por qué?”
“Es ciertamente verdad que ella podría
ser de gran ayuda en una pelea… si mi madre buena para nada y alguien tan
buena, joven y linda madre fueran a conocerse en el mismo lugar… ahórrame de
mostrar lo disparejo entre nuestras familias, o sea… ¿Lo entiendes? O más bien,
¡entiéndelo!” *¡Mirada!*
Los ojos de Wise una vez más se abrieron
ampliamente con intensa sed de sangre “¡Y-ya entendí! ¡Veo tu punto ya!” Un
hijo, que estaba feliz con una madre como Mamako, podría solo lograr el efecto
opuesto, había intentado conversela un poco más. Podría escuchar su deseo aquí.
“E-Entonces ls dos iremos primero. El
primer objetivo es intentar persuadirla al menos. Sin embargo, si eso falla, no
vamos a pelear. ¿Qué hay sobre eso?”
“Okay… Si es posible, antes de ver a esa
idiota, quiero revisar nuestra cooperación cuando el momento venga… ah, solo
encontré algo bueno.”
Algunas sombras estaban pululando entre
los árboles frente a ellos. El bosque era el habitad de monstruos. Aunque ellos
habían derrotado al jefe de área, no significaba que podrían desaparecer. Los
monstruos tienen amplio espíritu de lucha. Inmediatamente comenzaron sus
“¿Acaso necesitas una explicación para
“No, no es necesario. Ya tengo una
“¡Entonces, vamos! ¡Con un buen
sentimiento, cuida de mí!”
“¡Lo tengo! Primero, vamos a… ¡recibir!”
Lobos, venados, osos, bestias malignas
con colores de ojos cambiados vienen al ataque. Lidiando con eso primero fue el
rol de Masato.
Masato salto justo en frente de los
enemigos para atraer su ira. Entonces empujo su brazo izquierdo y desplego un
escudo defensivo – el efecto adicional de su chaqueta armadura. Él recibió los
ataques enemigos con una mano. *¡Crash!*
“¡Tsk! ¡Pero resisit!… ¡Van para
Empujando a los enemigos con su escudo,
Masato desenvaino su Espada Sagrada Firmament en un movimiento perfecto.
Al momento que cortó un lobo cercano.
“¡Wise! ¡Combo!”
“¡Cast Cancel! ¡Bomba・Fiamma(Explosión
de Flama)! ¡Además! ¡Bomba・Fiamma(Explosión de Flama)!”
Explosión tras explosión quemando a los
enemigos hasta las cenizas. ¡Una victoria abrumadora! “¡Muy bien!” “¡Ahora
bien, recoger el botín!” Entonces los dos comenzaron a reunir las gemas. Tener
dinero era un asunto importante.
Y buen, se siente como eso.
“Masato en defensa se siente bastante
bien. Hace la pelea en verdad fácil. Tal vez tenemos una buena combinación.”
“Eso es verdad. Más bien, continúa
recolectando. Recibí algo de daño que mi auto-recuperación del equipo no ha
tomado aún.”
“Si vas a pelear con esa idiota, Masato
recibirá primero el ataque, guardare mi poder y esperare por una oportunidad.
Al siguiente turno Masato atacara, yo daré el combo, y la arrojare lejos en una
“No, espera, tú necesitas añadir un buff
de recuperación en tu acción. Un defensor débil morirá sin recuperación. Es
como con los conejos, cuando lo dejas demasiado tiempo solo, mueren prontamente
por la soledad.”
“Parece que los conejos, contrario a la
creencia popular, no mueren por estar solos por un largo tiempo, ¿sabes?”
“Eh, ¿en verdad? No sabía eso… más
importante, es sobre recuperación.”
“Si si, lo entiendo. Cuando el momento
venga, seré flexible.”
Recolección de gemas completa. Ahora
“Vamos a ir entonces… es lo que quiero
decir, pero hablado de ello, a donde deberíamos ir…?”
“No te preocupes. Conseguí un mapa de la
localización donde el jefe de la villa iba a entregar el sacrificio. Dejando la
guía a mí.”
“Entendido. Entonces… vamos.”
Ellos chocaron puños ligeramente y se
adentraron a lo profundo del boque. Profundo dentro de la oscuridad.
“…Basado en mi presentimiento, debería
ser pronto.”
“Me siento de la misma forma.
Necesitamos estar alerta desde aquí.”
Siendo incluso más precavidos, ellos se
movieron delante entre arbustos mientras evitaban el camino.
Gentilmente empujando de lado las hojas
y ramas para echar un vistazo… en el espacio abierto del bosque, algo parecía
estarse moviendo.
Bajo la luz de la luna, una sombra se
elevó. Fue un vórtice de oscuridad.
“Oi, que es eso… remolino… he visto
agujeros warps como eso en otros juegos antes, pero…”
“Es exactamente eso… ya viene.”
El vórtice oscuro repentinamente acelero
sus revoluciones y se expandió en sí.
Después de llegar al tamaño de una
entrada, un fuerte perfume floto desde el otro lado. Algo estaba saliendo
Pronto, se mostró a sí misma.
Era una mujer hechizante con piel bien
bronceada. Su cuerpo, envuelto en un despampanante vestido de noche, era bien
dotada, delgada, y abundante. Sus miembros eróticos se balanceaban en
movimiento como ella camino delante.
Más que nada, lo que atrajo la atención
de Masato eran los dos cuernos creciendo desde ambos lados de su cabeza.
Aquellos feos y retorcidos cuernos claramente probaban que ella no era humana.
como un demonio… Esta es la Reina de La Noche, huh…
El oponente era la madre de alguien y él
estaba al tanto de ese hecho que podría ser uno de los jugadores de prueba. La
Reina probablemente uso una magia de transformación para cambiar su apariencia…
Masato echo un vistazo a Wise, que de alguna forma le recordaba a ella, y
enfoco su atención a la Reina de nuevo.
La Reina llego chasqueando ligeramente
sus dedos. Cinco bishounen semi-desnudos inmediatamente caminaron fuera, juntando
sus cuerpos como gimnastas y creando una silla. La Reina se sentó como si fuera
natural y sonrió hechizantemente.
“Fufufu. Hoy es un día memorable. El día
que conseguiré mi sexto hijo. Qué tipo de niño será, me pregunto… aah, eso es
cierto. Podría quedarse en una pose de puente y dejar sus músculos abdominales
volverse una mesa. Eso sería bueno. Presionando mi mano en estos, estrujando
aquellos músculos con mis dedos mientras como salchichas… ¡Ufufufu! ¡Lo más
Ella carcajeo, eso parecía alegrarle
desde el fondo de su corazón, fue incluso más fuerte mientras la Reina
continuaba murmurando.
Un. Ella era el tipo de persona que no
quería él ser involucrado.
Viendo esa escena, Masato fue
francamente estupefacto por no conocer razones, como para Wise.
“… Esa madre idiotaaaa… Que tan estúpida
debe llegar a ser para estar satisfechaaaaa…!”
Ella ya se había ido. Ella seriamente se
quejó. Las venas sobresalían increíblemente.
“¡C-cálmate, Wise! ¡Razonemos con ella
primero! ¡Hablar viene primero!”
“¡Es demasiado tarde para palabras! ¡En
verdad oído que esa cosa sea mi madre! ¡Voy a asesinar a esa madre estúpida y
entonces morir también!”
“¡Cálmate! Si haces un alboroto…!”
“Si. Por supuesto lo notare.”
La Reina miro sobre su dirección, un grueso
y bien sellado grimorio había ya sido materializado en su mano.
Un ataque estaba viniendo.
“¡Oi oi! ¡Ella repentinamente quería
pelear! ¡No hay momento para charlar!”
“En ese caso, vamos a cambiar el plan!
¡Vamos a volarle lejos y forzarla a crecer, entonces después de una hora de
sermones, hablaremos sobre eso! ¡Vamos, Masato!”
“¡No se puede evitar! ¡Vamos a hacerlo!”
Masato y Wise corrieron hacia ese trono,
en ese instante.
El ataque preventivo de la Reina. La
magia con Cancelación de Casteo activado desde su trono ataco a Masato y Wise.
Sin embargo, Masato no fue afectado.
La magia de Wise fue sellada.
“Muy bien, estoy fuera. Retirada.
Gracias por el trabajo duro. Ah geez no puedo hacer esto.”
“¡Oi, espera solo un minuto, tú chica
inútil! No te rindas tan rápido…!”
Como Wise estaba mirando por un lugar
para acostarse alrededor, la magia de la Reina fue activada de nuevo. El dios
de la muerte penetro a través de Wise, y después instantáneamente murió, ella
fue encerrada en un ataúd.
“¡Oi oi oi oi! ¡Eso es demasiado sin
piedad!… ¡Maldición! ¡Ya que llegamos a esto, lo hare por mi mismo!”
Decir eso parece ser sin sentido. Como
Wise dijo, él tenía que derrotarla primero, entonces hacerla escuchar. No
parece haber otra elección. En ese caso.
Pateando lejos su ansiedad, dio un paso
con valentía, Masato corrió a la Reina de La Noche instantáneamente.
“¡Ooooooo!” La espada sagrada del cielo Firmament reflejo la luz de la luna
como la balanceo audazmente.
Y el tajo atrapo a la Reina… sin
embargo, lo que corto fue una pieza del Velo de la Oscuridad que fue desplegado
alrededor de la Reina. Él no podía causar algún daño del cuerpo actual.
Para hacer el asunto peor, el velo
desecho fue rápidamente reparado, y las dos capas inmediatamente se recuperaron
para ser tres.
“¡Tch! Este es la defensa invencible
basada en turnos ¡huh! ¡Qué problemático!”
“Fufufu. ¿Lo siento por ser
invencible?… Hablando de eso, ¿Quién eres? Repentinamente atacándome sin
incluso saludar, ¿no tienes algunos modales?”
“¡Lo siento sobre eso!… ¡Soy un
compañero de esa Sabio muerta de ahí! ¡Porque esa tonta quería persuadirte,
hice una galante entrada para ayudarla, como un héroe ocupado!”
“Oh, es eso así…”
Escuchando la plática de Masato a
medias, los ojos de la Reina se distorsionaron con inconformidad. Ella parece
estar molesta.
“Haa… que estúpido. Aah, que
“¡Despreciable, dices, eso no es como
es! Wise estaba inesperadamente preocupada sobre…!”
La Reina de La Noche levanto su dedo
índice y presiono. Una presión invisible quemo instantáneamente, enviando a
Masato a volar lejos con un furioso momentum.
“¿¡Gaha!?… O-Oi… porque… eso fue,
magia solo ahora… algo era diferente…?”
“Solo moví mi dedo, ¿sabes? En verdad
fue solo eso… Fufufu… ¡ahahahaha!”
La Reina hizo un gran balanceo de su
brazo, en ese instante, el espacio grito como fue distorsionado.
Una onda de choque invisible de su dedo
podría fácilmente lanzar a una persona lejos. Con este poder feroz encantado
varias veces debido al incremento del tamaño, esto ataco a Masato justo como
eso. “!?” Él jadeo en dolor como su espalda golpeo un árbol.
Repentinamente noto que no podía mover
su cuerpo.
“Guh… ¿¡oi, que es esto!?… Hah…
¿¡efecto de parálisis!?”
“Si si, es eso. Infringe un estado
temporal de inmovilidad, o algo como eso. Había solo recibido una simple
explicación así que aprendí poco sobre eso. Pero es conveniente. Después de
eso, solo… necesito hacer esto, supongo.”
La Reina elevo su mano. El vórtice
oscuro en su espalda rápidamente cambio en una forma cónica. El punto afilado
daba hacia Masato. Él estaba en su inevitable curso de perforación.
Después de terminar sus preparativos
para terminar la pelea, la Reina escupio.
“De seguro tienes algo de coraje,
mostrándote ahora sin alguna preocupación. ¿Acaso pensaste que podría hacer
algo por apelar a mis sentimientos? Aah, tan despreciable. En serio
problemático. Algo como padre e hijos… Hmph, bueno, lo que sea. Una molestia
solo necesita ser eliminada. Tú te mostraste aquí, así que solo como castigo.
Desaparece en este instante.”
“… ¿¡estoy acabado!?”
Él no podía incluso tomar una postura
defensiva, podría solo esperar la derrota.
Y, en ese momento, la tierra
repentimanete se sacudió. La vibraciones gradualmente incrementaron en fuerza.
“¿Un terremoto?… No, esto es
“Este temblor… ¿¡podría ser!?”
Es justo lo que ‘podría ser’. El suelo
ante Masato repentinamente salto arriba, y una torre afilada perforo fuera.
Él recordó esta escena. Esto era… encontrando
la localización de su hijo sin importar que tan lejos estuviera, interfiriendo
cualquier situación que pasara en ese lugar, la habilidad de apoyo【Colmillo de
Eso significa…
“¡Maa-kun! ¡Estas por ahí! ¡Mama está viniendo
Ella vino. Fue Mamako. Armadura plateada
adornando sobre su vestido de una pieza, su mano derecha sostenía la Espada
Sagrada de la Madre Tierra Terra di Madre, su mano izquierda sostenía la Espada
Sagrada de la Madre Mar Altra, cargando a Porta en su espalda, Mamako
galantemente apareció.
Su aparición bajo la luz de la luna fue
llena de dignidad, como un héroe llegando a proteger a quien sea del peligro.
“¡Mama-san! ¡Voy a echar un vistazo a
“Por favor hazlo. Voy a dar mirada por Maa-kun…
es lo que quiero decir… antes de eso, parece que hay alguien que necesita un
“Ah, ¿crees ser capaz de ser mi
oponente? Yo soy, en verdad fuerte, ¿sabes?”
“Ser fuerte o no, no es lo que importa…
¡Sin importar quien seas, no puedo perdonarte por hacer cosas crueles a mi
lindo hijo! ¡Lo juro en mi nombre como madre que no te lo perdonare!”
Fue en un instante. Mamako ya cerró la
distancia entre ella y la Reina, balanceando en cruz sus espadas sin piedad,
apuntando a su cabeza. [Kiel: Se rompió la jefa… ¡corre perra, correeee!]
El Velo de Oscuridad defendió de su
ataque. Sin embargo, múltiples hojas de piedra y balas de agua siguieron tras
esos tajos lloviendo sobre la piel de la Reina, fueron superficiales, pero la
“¿¡Guu!? ¿¡C-Como!? ¿¡Esta gran yo fue
No recibió un montón de daño, pero los
ataques habían ciertamente conectado. La impactada Reina activo su magia en
“¡Barriera (Escudo)!” Ella
desesperadamente apilo sus defensas.
“¡Esto no acabo aún! ¡Aquí va!”
“¿¡Q-Qué!? ¿¡Cómo es que atacas tan
seguido!? ¿¡No eres demasiado irracional!?”
En realidad, el ataque de Mamako
consistía principalmente en las hojas de piedra y balas de agua que aparecían
con sus movimientos de espada, mientras los tajos no fueron tomados en cuenta.
Sin embargo, la defensa invencible de la
Reina fue basada en turnos. Incluso si no había daños, podría contar como un
turno de ataques con un cierto grado de impacto, removiendo una capa de la
“Tengo algunas lamentaciones, pero… como
esperaba, mi mama es en verdad genial… demasiado fuerte…” [Kiel: Esta ropa
papa… Sus ataques evitan que se remplacen las capas ya que el turno no acaba
hasta que termine el ataque… lol]
Persiguiendo con abrumadora velocidad,
Mamako destruyo defensa tras defensa. La Reina desplegaba escudos defensivos
después de los destruidos. Sus ataques y defensas intercambiados eran como una
tormenta furiosa. Especialmente la secuela del impacto del ataque a todos los
objetivos de Mamako, que derrumbaba los árboles y hierba fácilmente y
destrozaba la tierra con fuerza tremenda. En verdad, una batalla fiera.
Masato estaba mirando a su estado
“¿¡Ha!? ¡No es bueno! ¡Mi rol!”
Eso es cuando Mamako noto la mirada de
Masato, ella empujo a la Reina con un golpe usando toda su fuerza y
apuradamente fue a Masato para pedir por permiso. ¿Eh? ¿Qué es esto?
“¿H-Huh? Mama, que es todo eso de
“¡Lo siento, Maa-kun! ¡Aunque el rol de
mama es apoyar a Maa-kun, ella se fue por la borda! ¡Pero mama lo noto! ¡Qué es
lo que mama debería hacer desde ahora!”
Mamako mostro una sonrisa gentil,
sosteniendo su mano y diciéndole.
“Vamos, Maa-kun. ¡Ahora es el momento!”
*Ve delante.*
“¿¡Esto no es ‘Ahora es el momento’
cierto!? ¿¡Incluso si me lo dejas a mí, estoy aun en problemas! ¡No hay
oportunidad o lo que sea para mi del todo! ¡Cómo puedes ver, no puedo moverme!”
“¡No hay forma! ¿¡Entonces, sería mejor
dejarlo para después!?”
“¡Soy el único que quiere saber eso! Más
importante, en lugar de mí, ve a ser el oponente de la Reina… espera… ¿aah?”
Ante sus ojos “¡Kuh! ¡Tengo que
improvisar las configuraciones algo más!” La Reina expandió el vórtice oscuro y
escapo mientras dejaba su silla bishounen. Su figura desapareció en un
El contacto con la Reina de La Noche
termino en un fracaso.
Después de la batalla, ellos
inmediatamente abrieron una reunión de reflexión.
“¡Como dije! ¡Deberías terminarla, mama!
¡Esta bien empujarla alrededor con tu poder de fuego y sacar fuera todo!
¡Derrotarla como eso podría haber sido bueno! ¿¡Porque te retiraste!?”
“¡P-Pero Maa-kun!”
“Mama no puede escupir fuego. Mama no es
una estufa.”
“¡Como te he dicho, no estamos hablando
de estufas aquí, cuantas veces tengo que repetirlo! ¡Poder de fuego básicamente
significa poder de ataque! ¡Recuerda eso!”
“E-eso es cierto. Lo siento, mama es
mala recordando cosas… en verdad lo siento…”
Mamako mostro un rostro lamentable y
bajo su cabeza profundamente.
Pero antes de eso.
“¡Ah, no! ¡Detente un momento!”
Masato presiono las mejillas de Mamako
con sus manos y elevo su rostro. “¿Funya? ¿Maa-bun?” el rostro apretujado de su
madre ante él “¡Presione el lado equivocado!” De todos modos, él elevo su
¿A salvo por poco? No siento que esto
sea un out. Sin embargo, Masato fue capaz de notarlo.
“No puedo evitar ponerlo con este
momento… entonces será lo mismo que antes.”
Eso no es. No puedo hacer eso. Él creía
que no debería hacer eso.
Él debería hablar honestamente. Su madre
estaba aquí escuchándole, así que se calmó.
Necesitaba propiamente converger lo que quería
decirle a ella.
“Ah, erm, ya vez…. Esto no es como así,
eso no… No quiero decir que me queje de mama, solo quiero que seas más
cuidadosa. Siento que debo solo darte una lectura sobre qué es lo bueno a
“Si, mama entiende. Maa-kun está
pensando en el bien de mama, e intenta enseñar a mama sobre las cosas
importantes, ¿correcto?”
“Eso es correcto. Es por eso que no me
trates como un niño… erm… eso es más o menos, así que… por favor trabaja un
poco duro la próxima vez. Definitivamente te enseñare.”
“Si. Mama trabajara duro.”
El rostro sonriente de Mamako floreció,
Masato asintió. Y en lo profundo de su corazón, él estaba aliviado. Es cierto,
esto está bien. Convertirlo de esta manera es bueno. Esta es la elección
correcta. Puedo hacerlo si lo quiero hacer.
Él sentía que había de alguna forma
crecido y saboreado la alegría.
“… Ahora bien, de vuelta al tema
Masato miro de vuelta hacia Wise que
está un poco lejos de ahí.
Wise estaba en un extremadamente mal
humor. Como una niña malcriada ventilando su enojo por abrazar un oso de
peluche, ella abrazo a Porta que estaba sentada en su regazo, y tenía una
mirada agria en su rostro.
“Oi Wise. Primero, libera a Porta. Ella
parece estar en problemas cuando la tratas como un peluche.”
“Porta no está en verdad molesta.
“¡S-Sí! ¡Estoy totalmente bien!
¡Continuare siendo un peluche!”
“Si Porta está bien con eso, entonces
bien… En cualquier caso, Wise. Ya que todos se han reunido, ¿podrías decirnos
la historia?”
“No solo me muestras como son de
cercanos son el par de madre e hijo, ¿quieres que revele mi situación terrible?
¿Qué tipo de acoso es ese?”
“No, no lo quise decir de esa manera,
pero… Ya he supuesto un poco de eso, ¿así que no debería ser mejor decirle
propiamente a mama y Porta? Somos compañeros. Permanecer ignorante es, bueno.”
“Haa… Lo sé ya. Solo necesito decirles
cierto, solo decirles.”
Wise dejo salir un gran suspiro, y hablo
mientras miraba a la luna.
“La persona que se llama a si misma
Reina de La Noche… ella es mi mama.”
Mamako fue tomada por sorpresa después
de escuchar aquellas palabras. Su rostro instantáneamente se tornó pálido.
“¿¡Eeh!? ¿¡Esa persona es la mama de
Wise-chan!?… ¿¡Hey Maa-kun, es eso verdad!?”
“Aah. Parece ser que ese es el caso.
Ella luce totalmente como un demonio, pero eso es probablemente una magia de
“Eso es correcto. Mi mama es
definitivamente una humana. A ella no le crecen cuernos… su pecho es también no
tan grande. Más bien, eso fue demasiado. ¡Es demasiado pretenciosa!”
“Como podría eso ser… q-q-q-qué deberías
hacer mama… mama peleo con ella sin pensarlo…”
“Ah, está bien, está bien. No tiene que
preocuparse sobre eso. Yo también quería arrojarla lejos… Porque ella es una
madre idiota, que no mira a mi camino si no hace al menos eso tanto. Ella es en
verdad la peor.”
Mientras gentilmente acariciaba la
cabeza de Porta, Wise recordó la apariencia de su madre.
“Mi mama fue enganchada en los clubs de
anfitriones* en el pasado, así que no podía parar de jugar con hombres como
esos… por cierto, mi nombre real es [Genya], pero es de hecho el nombre de un
anfitrión profesional en el que ella estaba interesada.”
[Kiel: Disculpen que interrumpa, los
club de anfitriones o host club, es algo así como un antro o cabaret donde
ambas partes toman un rol, dependiendo el tema del local, no tengo que decir el
tema que le gustaba a la madre de Wise/Genya… hay un anime que trata sobre esos
host club… google-sensei, ahí se los mando…]
“Eh, es en serio…”
“Usar el nombre del anfitrión para el de
su propia hija…?”
“El nombre real de Wise-san es
“Eso es como esta… eso es como es… kuh…”
Genya retuvo las lágrimas con toda su fuerza…
Ya que sentía enojo y dolor hacia su nombre real, podría ser mejor si
continuaban llamándola Wise desde ahora.
“¡Debido a que mama es como eso, mi casa
es un poco pobre! ¡Mama ha gastado todo el dinero en casa! ¡Ella incluso usa
los gastos de comida de su hija en anfitriones!… Incluso papa no pudo
resistir más, así que se divorciaron. Por supuesto, decidí vivir con mi papa.
Eso iba a resolver todo… al menos, eso fue lo que pensé… hasta un día, mama
repentinamente se mostró.”
“¿Algo como querer reconciliarse con su
“Es exactamente eso. Como me negué
fieramente, ella menciono este juego, e irrazonablemente intento volverse más
íntima… Una vez ella noto que ella podría hacer un montón de dinero porque fue
un poco fuerte, ella dijo algo sobre liberar estrés y comenzó su sueño ‘Jugar
con hombres’ mientras me trataba como una molestia. Cuando me harte con ella
‘¡No me fastidies!’, fue básicamente un adiós.”
Ella se burló bruscamente.
Wise miro a Masato y los otros y
débilmente rio con un rostro medio caído.
“Y bueno, es así como me siento. Ya ha
“Terminado, dices… tú…”
“Lo dije justo ahora, ¿no es así? Más
que escucharme, ella me golpeo con una magia de muerte instantánea al momento
que me mostré. Ella no se preocupa por mí para nada.”
“¡U-Umm! No quise decir eso…!”
“Está bien, está bien. No necesitas ser
considerado. Yo también no me preocupo sobre ella. Mi relación madre e hija
está ya terminada…”
“¡Eso es absolutamente imposible!”
Mamako claramente le negó.
Mamako se puso de pie frente a Wise y
hablo de nuevo mientras miraba directo a ella.
“Eso no es posible. La relación Padre e
hijo no puede terminar. Eso nunca puede terminar.”
“Espera, Mamako-san… que estas en
“Pero esa es la verdad. Padres e hijos
son algo sobre genes o árboles familiares, algo que no puede ser cortado
incluso si lo intentas. Porque los padres e hijos son eternos.”
“No, bueno, Mamako-san y Masato tienen
una buena relación, así que actualmente siento que es así como todos los padres
e hijos son, pero yo totalmente…”
“Eso no es posible. Wise-chan tal vez se
sienta así. Solo no estas notándolo, pero tú en verdad lo tienes dentro de ti…
¿Puedes permitirme un momento?”
Mamako jalo la mano de Wise para que se
levantara, y la trajo cercas de ella así.
Ella sostuvo ligeramente a Wise contra
su pecho.
“Hey, Mamako-san… qué…”
“Ahora, Wise-chan. Siente mi abrazo
firmemente. ¿Cómo es?”
“Como, preguntas… Los pechos de
Mamako-san son grandes, suaves, y dan una buena fragancia…”
“Sin embargo, algo está mal, ¿cierto? Es
un poco diferente.”
“Eso es… por alguna razón, es diferente
a lo que siento que yo conozco, en verdad tengo tales pensamientos… la
fragancia es también diferente, no en un mal sentido, es como si esto no es…”
“¿Qué es lo que es diferente?”
“Que preguntas, eso es por supuesto mi
mama… ah…”
Wise parece haber notado repentinamente

Ella no sabía si fue desde que ella
nació. Fue algo natural sin que ella lo notara.
Fue algo incomprensible, incierto, pero
también innegable, un sentimiento que definitivamente existía.
Estaba definitivamente dentro de todo el
mundo, un ‘eso’ de padres e hijos.
“Hey. No acabo. Wise-chan
definitivamente tiene eso… Es por esa razón, ¿okay?”
Mamako cambia su mirada hacia Masato,
mostrándole una sonrisa.
Lo que significaba eso era… no había
necesidad de preguntar esa cuestión.
“Revancha es, entonces.”
No fue por alguna gran tarea para salvar
el mundo. Fue por el bien de alguien cercano a él, por el bien de reparar ese
lazo retorcido entre una madre y su hija.

La cortina de la batalla que el héroe ordinario que no podía permitir perder fue elevada.

Okaa-san Capitulo 4 (Parte 2)

Capitulo 4: Él nunca pensó una vez que tener una madre entendiendo fuera bueno
¡Alzare (Despertar)! ¡Además! ¡Reanimato (Resurrección)!”
Wise uso Chainspell. Magia de despertar
para levantar a Mamako y Porta, y resurrección para revivir a Shirase. La monja
con un rostro insociable elevo su cuerpo.
“Esto es todo el mundo. Nos encontramos
de nuevo. Soy la Misteriosa Monja Shirase. Soy Shirase que no informa lo que
ese misterio es.”
Ella parece haber regresado a ser una
persona incomprensible como siempre. Esto era mucho mejor que esa molesta
persona sociable. El equipo de Masato golpeo sus pechos en alivio.
Ahora bien. Sin ir más allá.

““Shirase-san. Oi.””
Masato y Wise estiraron sus manos al
mismo tiempo. Con sonrisas muy buenas, “Entrégalo. Ya”, ellos dicen.
“… ¿Si? ¿De que tratan estas manos?”
“Obviamente, nuestra recompensa.
Recompensa. Solo pensamos en tomar la recompensa de la quest.”
“Porque derrotamos al jefe. Tú dijiste
que debería haber una recompensa, ¿correcto?”
“Ya veo… pero lamentablemente, hay una
cosa que tengo que informarles sobre eso. La Raiz Demoniaca aquí era el jefe de
área del bosque, y no el objetivo quest de mi solicitud. La quest que solicite
comienza justo ahora.”
““Eh… en serio…?””
“En serio. Sin embargo… parece que
apareció esto en un lugar diferente del configurado… la capa del bosque también
parece haber cambiado… y mi condición justo ahora fue justo como hackeo de
cuenta… como pensé, la posibilidad de esa persona modificando es…”
“Erm, ¿Shirase-san?”
“¿De que estas murmurando? No puedo en
verdad escucharte.”
“Lo siento sobre eso. Solo hablaba
conmigo misma, así que no importa… Ahora bien.”
Shirase ligeramente junto sus manos en
una postura de rezar.
“Bien entonces, estoy agraciada por esta
reunión. Permítanme solicitar su ayuda para una quest.”
“¿Y el contenido principal es?”
“Poseyendo el raro y fuerte lazo
padre-hijo, usando su poder, por favor resuelvan el incidente que pasa en la
Villa Maman adelante.”
Eso fue lo que dijo.
“Erm… ¿tal vez una explicación más
detallada ayude?”
“Por favor investiguen sobre eso en la
villa. Reunir la información necesaria es también parte de la quest.”
“Deberías solo decirnos sobre eso.
Malgastaras nuestro tiempo.”
“Esto es también una forma de la belleza
de estilo[1]… Ahora bien, vamos a partir. También estaré
dirigiéndome contigo a la Villa Maman.”
“¡Bueno! ¡Shirase-san se ha también
vuelto nuestra compañera! ¡Mama está profundamente conmovida!”
“¡Creo que incrementar el número de
compañeros es una cosa buena! ¡También soy profundamente conmovido!”
“¿Eh? Francamente hablando, no puedo
soportar esta persona a pesar.”
“No tengo algún problema en particular.
Entonces, en esa nota.”
Misteriosa Monja Shirase se volvió su
Entonces Shirase casualmente se movió al
lado de Wise. “Ya dije que no te soporto, ¿¡porque vienes más cercas!?” “Esto
es solo acoso. Fufufu.” Como ellos sabían que podría gustarle hacer algo como
eso, los otros compañeros miraron a ellos cálidamente.
“Ahora, vámonos… Hablando de eso,
Mamako-san, ¿Cómo es la vida aquí? Si hay algún inconveniente, nosotros
inmediatamente lidiaremos con ello.”
“Hmm, vamos a ver… Quiero malcriar a
Maa-kun un poco más… Por ejemplo, abrazarlo firmemente o algo parecido.”
“En ese caso, ¿Qué hay sobre volver las
fuentes termales en Villa Maman en una mixta? Es la así llamada piel libre.
Masato-kun podría ser incapaz de retenerse y venir a aferrarse a ti. Algo como
conseguir intimidad peligrosa.”
“¿¡Qué debería hacer mama!? ¡Mama está
en problemas!” *Oh no. Esto es tan embarazoso.*
“Ella no quiere decirlo de esa manera,
¿¡cierto!? No en la manera prohibida, ¿¡cierto!?”
“Otro a eso, ¿que hay sobre administrar
algo de medicina? Este mundo está fuera de la aplicación de la Ley de Asuntos
Farmacéuticos, así que puedes usar cualquier tipo de medicina que quieras.”
“¿Está bien no tener Ley de Asuntos
“Eso no, pero usar objetos y venderlos
podría ser otra forma de ser restringido. Este tratamiento es inviolable.”
“Ah… Haber sido usados normalmente, pero
medicina de recuperación es aún una droga farmacéutica…”
Con ellos enredados en una conversación
vivaz con rastros de temas de medicación peligrosa, ellos dejaron el Bosque
Después de pasar a través de algunos
grupos de árboles, el escenario de la villa se expandió ante ellos.
Hay unas pocas casas construidas entre
amplios campos y bueyes estaban caminando cercas de los caminos del campo. La
luz del sol fue gentil, el viento era gentil, y las voces quejándose apuntaban
hacia los niños jugando alrededor de las cosechas eran también gentiles. Eso
era la Villa Maman.
Mientras tanto.
“Entonces, me voy. Nunca olvidare el
número de pasos que he caminado con todo el mundo.”
Shirase dejo de ser su compañera.
“¿¡Eeh!? ¿¡Repentinamente alejándose!?
¿¡Aunque hemos solo caminado alrededor de treinta pasos juntos después de
volvernos compañeros!?”
“El numero correcto es veintiocho pasos.
Mi promesa fue caminar con todo el mundo hasta la Villa Maman. La promesa ha
sido completada, esta es la regla del estilo Shirase.”
“Shirase-san, ¿puedes estar con nosotros
un poco más? Quiero charlar con Shirase-san algo más.”
“Estoy muy feliz por tu sentimiento,
pero tengo algunos otros trabajos desde ahora. Por favor perdóname. Bien
entonces… ah, antes de eso.”
Shirase trajo sus labios al lado del
oído de Wise.
“Tu madre parece estar cercas, así que
creo que deberías usar esta oportunidad para hablar con ella un poco. ¿Podrías
querer acompañarme?”
Masato sobre escucho el contenido de ese
susurro secreto por coincidencia fue un secreto.
Wise parecía un poco perdida, pero ella
volteo de vuelta a Shirase.
“… ¿Por qué no te apuras y te vas? Ya
que no tengo nada que decir.”
“Ya veo. Entonces no se puede evitar…
Ahora bien, todos. Doy mi despedida aquí. Por favor estén bien hasta vernos de
Shirase cortésmente se excusó a sí
misma, entonces se dirigió a la Villa Maman.
Él estaba un poco preocupado sobre Wise
que estaba mirando a otro lado, pero lo dejo pasar por ahora.
“… Ahora que eso está hecho, ¿Qué
deberíamos hacer?”
“Incluso si preguntas que hacer… ya que
ella tiene algunos asuntos, no se puede evitar. Después de decir adiós a
Shirase-san, deberíamos ir a la Villa Maman.”
“Eso es verdad. Entonces, vámonos.”
Llegando a términos con esa ligera
soledad, el equipo de Masato camino hacia la villa Maman.
Sin embargo, como resultado de su
destino siendo el mismo, se sentía como si estuvieran siguiendo a Shirase, que
estaba caminando delante. La distancia entre ellos era cerca de dos metros, pero
ya que había una leve despedida, se sentía mal llamarla a ella.
Tan… Extraño…
Las cinco personas, incluyendo Shirase,
continuaron caminando en esa sofocante atmosfera sutil.
“Lo siento por molestarle cuando está
ocupado. ¿Puede permitirme un poco de su tiempo?”
“¿Eh?… T-todos, parecen ser
aventureros, ¿¡podría ser que pasaron a través de ese bosque!? ¡Wow, asombroso!
¡Todas tales jovencitas!”
“Oh usted, llamarme una jovencita. A
pesar de verme como esto, ya soy una mama, ¿puede ver a ese chico de quince
años de ahí? Él es mi hijo, Maa-kun… Hey Maa-kun, di hola.”
“¡Mama! Deja de presentar a tu hijo cada
vez que conoces a alguien, ¿¡acaso tengo que continuar diciéndote eso!?”
“¿¡Ueeeeeeeh!? ¿¡Podría ser que usted no
tiene quince años!?… T-tal joven y hermosa madre, es mi primera vez viendo
algo como esto desde que nací…”
“Gracias… Así que umm, ¿podría preguntar
algunas cosas?”
Como ellos hablaron con los aldeanos,
Shirase había ya entrado antes que ellos, “Gracias por cuidar de nosotros.” Masato
agradeció a ella en su corazón como escuchaba las historias de los aldeanos.
Basado en lo que escucho, parece haber
algunos problemas sembrándose en la Villa Maman. Sin embargo, habían escuchado
del jefe de la villa para los detalles, así que rápidamente fueron a su
“Geez… Deseo que podrían decirnos
rápidamente sin malgastar nuestro tiempo…”
“Honestamente siento lo mismo, pero no
diré eso. Esto significa para el estilo de la belleza. Estos aldeanos han
practicado un montón.”
“Ahora, donde podría ser la casa del
jefe de la villa…”
“¡Tal vez sea esa! ¡Mis ojos nunca se
Una sola residencia estaba delante, de
espalda hacia el bosque. Un anciano, aparentemente el jefe de la villa se
mostró sosteniendo un bastón, como algún aldeano probablemente llamo por él
Ellos entraron a la casa bajo la guía
del jefe de la villa. Por su historia, esto actuaba como la mansión del jefe de
la villa, punto de reunión de la villa, y también como alojamiento, ya que la
villa no tenía posada.
En el comedor de tal gran mansión, ellos
refrescaron sus gargantas con jugo shiso morado que sirvieron como bebida de
bienvenida, el jefe de la villa mostro su deber de decirles la situación.
“Paso hace unos pocos días. Un demonio
que se llama a si misma [Reina de La Noche] apareció.”
“Reina de La Noche… Demonio…”
“Con su repentina aparición, ella forzó
a los aldeanos en sumisión con su gran poder, e hizo una cierta demanda a
nosotros… ofrecer un sacrificio, si ustedes valoran sus vidas, ella dijo.”
“¿No me digas que necesitan ofrecer a la
chica más hermosa en la villa? ¡Que un clásico evento inamovible!”
Masato enfureció en ese punto. Él creía
que ponerse enojado era lo que el héroe debería hacer. ¿No esta eso bien? Sí, eso está bien… Sin embargo.
“Ah, no no, ella no quiere una chica.
Ella es una Reina de todas formas.”
“Ah, eso es verdad. Si ella es una
reina, entonces ella es una fémina también.”
“Si. Ella incluso dijo que no quería ver
a ninguna chica, a pesar de la situación… lo que ella demando fue [El más
atractivo y macho anfitrión en esta villa con músculos pectorales y abdominales
que no se cansen incluso después de ser estrujados por un día entero].”
“Heh… de alguna forma una imagen de un
en verdad tonta erotica MILF apareció en mi mente…”
Viendo la mirada de sus compañeras,
Mamako estaba sonriendo agriamente, Porta daba una linda mirada en blanco como
ella no entendía lo que significaba… Wise estaba sosteniendo su cabeza en
El contenido de su demanda de hecho
podría precaver este tipo de situación.
El jefe de la villa apelo con una
expresión llena de desastre.
“El sacrificio viviente fue prometido a
ser entregado esta noche. No hay mucho tiempo y no podemos rechazar. No hay
aldeanos que cumplan los requerimientos, también buscamos alrededor… cuando
estaba en problemas por esto, ustedes han llegado… umm, como podría pedirles…”
“Ah, ya se lo que el jefe de la
villa-san está pensando. Es básicamente ese tipo de cosa.”
“Si. Primero, con una sonrisa, yo diría
‘Por favor no importa y quédense aquí’. Entonces, prepararemos comidas gratis,
habitaciones gratis, servicio gratis a las orgullosas fuentes termales de
nuestra villa, entonces intentaran extender nuestra estadía incluso si es con
un poco de fuerza, y finalmente hacernos que todos derrotemos a la Reina de La
Noche de alguna forma, es lo que pienso.”
“Eso es bastante por encima de mis
expectativas. No es por confiar en nosotros, pero por una sonrisa huh… Bueno,
bien por mí.”
En cualquier caso, ellos habían ya
aceptado ser arrastrados por esta quest.
La penumbra arribo pronto a la Villa
Maman que estaba rodeada por un bosque. Sombras de árboles estrechos por el
ocaso del sol envolvían la villa, y la noche arribo rápidamente. Junto con la
oscuridad, el tiempo cercano a la promesa de encontrarse con la Reina de La
Noche se acercaba.
Sin embargo, antes de eso, ellos iban a
recuperarse de su fatiga del viaje y recuperar su fuerza primero.
“Kua~… No puedo
tener suficiente de esto~, esto es… un buen baño~, Mamama~n.”
En la fuerte termal amplia de espacio
abierto construida sobre rocas, Masato tenía la fuente termal entera para sí
La fuente termal, el orgullo de Villa
Maman, era también conocida como [Baño de Leche de Maman]. [Kiel: Nótese el
doble sentido… fufufu…]
Al instante que vio la señal de la
fuente termal detrás de la mansión del jefe de la villa, él dio un segundo
pensamiento antes de entrar ya que tenía miedo que su reputación podría ser
dañada, pero fue una fuente termal después de todo. Cuando se desnudó
despojándose sus ropas y orgullo, y sumergido todo hasta los hombros, “Que buen
baño~, Mamama~n” él ya
había sido esclavizado por la fuente termal.
“No es bueno~ Parece que
tal vez me vuelva más hermoso.” [K: ???]
Él observo el agua de baño blanco
lechoso y la salpico en sus mejillas, haciéndolas suavizar. “Hmm. Me va a dar
miedo mirarme en un espejo luego.” Masato murmuro como continuo con su masaje
“No, no, eso no es como esto.”
Este no era el lugar para cuidados de
belleza. Había algo que tenía que confirmar.
Masato llamo al baño de mujeres más allá
de la división.
“Ooi, mama. ¿Puedes escucharme por un
“¿Oh, qué es?”
Y la respuesta vino desde detrás de él.
Girandose, espero que no fuera el caso,
pero lo era. Mamako, con su cabello amarrado, estaba ahí como si fuera natural,
y entro al baño de aguas termales sin restringirse.
Por supuesto, su cuerpo no estaba sucio
en nada, desde la nuca a la espalda, y a su delgada cintura, el agua blanco
lechoso siguió su línea de cuerpo como si la delinearan… las gotas del agua de
baño se escurrían desde sus caderas.
Algo como eso, No debo ver, no debo ver nada. No mires, no mires.
“… Oi. ¿Por qué mama está aquí?”
“Ya que es una rara oportunidad, mama
estaba pensando en entrar junto con Maa-kun. Somos madre e hijo después de
todo, está bien, ¿cierto?”*
“Consentiré esto después de comprometerte
diez billones de pasos si esto fuera unas aguas termales exclusivas para
padres-niños, pero desafortunadamente, este es un baño público. Un baño público
que los aldeanos comparten.”
“Le pedí al jefe de la villa sobre esto,
y dijo que lo había reservado para nosotros hoy. Así que está bien.”
“Kuh, haciendo cosas innecesarias…”
“Es por eso… ¡apúrense y vengan, ustedes
dos! ¡Ahora es su oportunidad, cuando Maa-kun está mirando a mi cuerpo en
“¡No estoy mirándote como eso!… Más
importante, ¿eh?… Aquellas dos también entraran…?”
“Heey. No puedes girarte. Mira hacia
acá. Aquellas dos son aún chicas de edad joven, así que ten tacto.” *Squish.*
“… Por favor se más considerado sobre tu
hijo que está también en una edad joven.”
La cabeza de Masato fue empujada entre
aquellos rebotantes pechos ante sus ojos. Detrás de él, *¡Pita, pita, don!*,
alguien corrió hacia las aguas termales y salto dentro. “¡L-lo siento por
mantener la espera! ¡Ya estoy sumergida hasta los hombros, así que está bien!”* Porta parece haber entrado.
Solo Wise fue dejada, pero…
“¿¡Espera, en serio tenemos un baño
mixto!? Esta es una broma, ¿cierto? ¿¡Esto es imposible!?”
“Oh mí. ¿No puedes entrar a el agua
termal padre-hijo? Entonces no puedes volverte mi hija después de todo. Que
“¡No, detente! ¡Entrare si esa es una
posibilidad!… Si puedo volverme la hija de Mamako-san, entonces eso es lo más
importante… después de escuchar eso, entonces todo lo demás… grr grr…”
“Entonces por favor, bienvenida. Creo
que tú entiendes que dejar que tu toalla entre a las aguas termales es de malos
modales, ¿cierto? Soy estricta en tal tipo de asunto, ¿sabes?”
“¡Ya se eso! ¡No necesito tal cosa!”
Ella arrojo la toalla que estaba
ocultando su delgado cuerpo plano hasta los pies, y valientemente comenzar a
desnudarse más y más… y con un splash, Wise se sumergio en las aguas termales.
“¡Masato! Sí tu miras a este lado, tu
estas mue…”*
“Hey Wise-chan. No me gustan cuando una
chica usa ese tipo de lenguaje, ¿sabes?”
“Uu… ¡N-no hare nada incluso si miras a
este lado, pero mantenlo en moderación!”
En moderación también significaba que
debería estar bien si miraba, lo que implicaba que le fue dado permiso.
Mamako con dos islas flotantes (pechos) se
sumergió en las aguas termales. Porta con su importante bolsa de mano encima de
su cabeza sin dejar su lado. Wise estaba sumergida todo el camino hasta la
línea brevemente debajo de su nariz en nivel alto de modo alerta. Y entonces
Masato, que estaba de alguna forma sentado en seiza. ¡Los cuatro de ellos se
volvieron compañeros de baño mixto!
¡Individuo Masato 【Bastardo de
Baño Mixto Nivel 1】 título conseguido!

[Kiel: Las lineas señaladas con * son las frases escritas en la imagen…]

“Mama… que estás pensando…”
“¿Shirase no dijo también esto? Esto
puede promover la intimidad. Mama también cree que es una buena idea. Es por
esa razón con todo el mundo… ¿Estas feliz con el apoyo de mama?”
“Guh… en serio… cielo santo… Geez…”
No era una queja esta vez. Él no estaba
agradeciéndole, tampoco. Masato intento abstenerse de pensar salpicándose en el
baño… Aunque hablando francamente, era imposible estar centrado mentalmente.
“Ahora bien, vamos a charlar. Maa-kun
tenía algunas cosas que decir sobre la pelea contra la Reina de La Noche,
¿cierto? ¿Acaso mama acertó?”
“¡Si, eso! ¡Eso es!”
Masato salpico su rostro, reafirmando su
expresión, y comenzó su charla. Podría ser una charla seria respecto a las
tácticas de batalla desde ahora. Momento para prestar atención.
“La historia del jefe de la villa decía
que ella es un demonio, pero no sabemos lo que ella es de hecho. Por ejemplo,
su fuerza o patrón de ataque. En cualquier caso, necesitamos información
primero… dime mama, ¿el libro guía tiene alguna cosa escrita?”
“Sobre eso… el libro guía ha registrado
todo los datos de varios monstruos, pero no hay algún demonio con el nombre de
Reina de La Noche.”
“Incluso el libro guía no tiene datos…
eso es…”
Omisión. Estaba también la posibilidad
de un monstruo recientemente añadido. El juego en el que el equipo de Masato
estaba participando era dentro de la fase beta test. En cualquier momento,
podría haber una actualización antes de la liberación oficial, así que eso
Mientras tanto.
“La Reina de La Noche es tipo mágico.
Ataque, apoyo, recuperación, ella puede hacer todo. Encima de eso, ella tiene
Cancelación de Casteo, así que no puedes apuntar por la abertura durante el
canto. Además, ella tiene una defensa invencible basada en turnos, tal vez lo
haga un ataque en cadena de tres turnos o más por el motivo de dañarle. Un
oponente muy problemático.”
Fue Wise quien saco toda la información.
Mamako y Porta estaban mirándola en admiración…
Sin embargo, Masato no lo hizo. Por
supuesto, él estaba molesto.
“… Esos son un montón de detalles.”
“Por supuesto. Ya que ella es… a…”
“¿Ella es?”
“E-Erm… erm… ah, eso es… eso, eso… ah,
Wise ya estaba exudando sospecha, como
un ejemplo cliché de una persona sospechosa, sus ojos vagaban por aquí y por
allá, “¡N-no mires hacia acá! ¡Tú chico ero!” “¿¡Bu!?” Masato fue salpicado con
agua caliente del baño.
Sin embargo, detenerse no podría ser
digno de Masato. Esta fue la mejor oportunidad para fisgonear a aquellos
clavículas y la parte superior de esa petanko[2]. Ese fue un
importante deber.
“¡C-como dije! ¡No hay alguna razón
extraña!… Umm… ¡Sabia aquella información antes de unirme a ustedes! ¡Había
algunos rumores sobre esto! ¡Solo escuche sobre esto!”
“¿Y quieres que crea eso?”
“¡Créeme! ¡Somos compañeros! ¡Dudar de
tus compañeros es lo peor! ¡Basura humana!”
“Vas a ir tan lejos, ¿eh?… Ah, lo que
sea, lo tengo ya. Vamos a ir con eso, por el momento. Por el momento, eso es.”
“¡Solo haz eso!… Geez… hmm… de seguro
es caliente. Tal vez consiga un poco de jaqueca ligera. ¿No es esta agua termal
un poco demasiado caliente?”

Wise se levantó, y sus ligeramente enrojecidas caderas se sentaron en el borde
de la fuente termal. No parece ser solo debido al baño. Ella comenzó a abanicar
su cuerpo entero con sus propias manos, como se había puesto caliente…
Y entonces, Wise lo noto. Ella estaba
sentada desnuda ante Masato.
“… Uh… oh…?”
Él tenía una premonición que esa
doncella avergonzada podría explotar.
Sin embargo, Masato fue inesperadamente
calmado. Ya que había aceptado la resolución y rendido a esto.
“Bueno, detente, Wise. Dame algo de
tiempo para decir mis últimas palabras… Mama, en unos momentos, recibiré el
castigo por ver la piel desnuda de una doncella, tomando su magia llena de
vergüenza y entonces morir brevemente. Debido a la ocasión, estaré muriendo
múltiples veces. Sin embargo, por favor no te preocupes. Definitivamente
regresare a la vida.”
“Eso es verdad. Este es un juego después
de todo. Shirase-san también regreso a la vida varias veces. Entonces mama
creerá en ti y vigilare sobre ti.”
“¡Tengo objetos de recuperación
preparados, así que está bien! ¡Por favor no se preocupe!”
“Gracias Porta… Ahora bien, Wise. Sin
esperar más, ve delante.”
Por motivo de no involucrar a la villa,
Masato tomo su postura mientras con su espalda daba con el bosque… Sin embargo.
“¡H-Hmph! ¡N-N-No me subestimes! ¡Por
alguien como yo, castigarte en esta situación podría sentirse como una
recompensa! ¡A-A-A-Así que no hare eso!”
“Qué, acaso dices… no castigo, dices…
tú, ¿estás bien con eso?”
“¡Hng hng! ¿Estas lamentándolo? Hey,
¿estas lamentándolo? Si lo lamentas, entonces ve y cava un agujero alrededor de
aquí y continúa gritando ‘¡Muchas gracias!’ ¡Que no tuviste la oportunidad de
decir!… Kukuku… ahaha… ¡uwaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaan!”
Wise huyo. Ella abandono el castigo y
Masato, que a duras penas escapo de la
muerte, se abstuvo de murmurar.
“… Gracias, muchas gracias…”
por perdonarme, gracias por no herirme…
aquellas palabras deberían haber sido usadas correctamente, ellas se
dispersaron en el vacío del viento.
Mientras tanto, en la otra mano, en el
bosque detrás de la mansión del jefe de la villa, en una cierta localización.
Ahí no había piar de aves o zumbidos de
insectos, como si todos se fueron de ese lugar.
“Eso es extraño… de acuerdo a la promesa
durante el evento aguas termales, Masato-kun debería volar hasta aquí por
ahora, pero… él no vino, huh.”
Shirase ligeramente chasque su lengua en
su mente. Esto fue totalmente fuera de su expectativa.
Si alguna conmoción hubiera pasado justo
ahora, ella tal vez haya sido capaz de usar la brecha cuando la otra parte
estuviera distraída para escapar. La villa, que ella podría ver desde lejos,
era aún bastante quieta… mientras tanto.
“¿Qué sucede?”
“… No, no es nada.”
Con una voz llena de alegría llamo por
ella, Shirase dejo de mirar atrás y miro delante.
Sin embargo, ella no miro a la otra
persona. El escenario de ahí… tal vez sería una lujosa visión para alguna
gente, pero era un feo escenario para aquellos que no tenían tales
Cinco bishounen[3]. Todos
ellos medio desnudos, uno estaba arrastrándose en cuatro actuando como un
asiento, uno estaba de pie aún actuando como el respaldo de la silla, dos, uno
a si derecha e izquierda, estirando sus brazos para actuar como descanso de
brazos, con el ultimo agazapado como una tortuga para servir como descanso de
Quien estaba sentada en la silla
bishounen hecha de los cuerpos de dichos bishounen estaba la Reina de La Noche.
Piel bronceada, cuerpo glamoroso, y
cuernos como cordero en su cabeza… La reina demoniaca no arreglo su desinhibido
vestido de noche obsceno, y miro encima con una mirada astuta, mostrando su
indulgencia en vino de uva y la silla bishounen.
“Así que, ¿Qué es? ¿Acaso aún tienes
algo que decirme?”
“No, nada. He entendido tu actitud muy
“¿Entonces que deberíamos hacer?”
“Tus acciones han grandemente desviado
de la intención original del juego. Como tal, no tenemos elección sino tomar
acción y dejar de proveer servicio a usted por romper los contenidos del
contrato que firmaste en el comienzo.”
“¡Oh mí! ¿Es eso así? Que desafortunado…
Pero estaré en problemas… No parece estar bien en ser razonable… Tal vez
inesperadamente tome represalias.”
“Es inútil. Hemos ya hecho arreglos para
neutralizarte… Ahora bien, sin más demora.”
Shirase rápidamente elevo su mano. Esa
fue la señal.
El Administrativo monitoreando la
situación en vivo de aquí respondiendo a la pista, y activo terminación de
cuenta forzada. La Reina de La Noche debería ser desconectada sin una duda…
Eso se suponía que pasara, pero.
“… ¿Eh?”
Nada paso.
La reina estaba aún sentada en la silla
bishounen, justo ante Shirase sin un cambio.
“Ufufu. ¿Qué paso? ¿Podría ser que
querías eliminarme desde el lado del Sistema?… Pero es inútil. Tengo un poder
“¿Poder especial? Que exactamente…”
“Bueno, que podría ser… ¿Has terminado
ahí? Entonces vamos a terminar.”
La Reina de La Noche agudizo su mirada,
y entonces apunto a Shirase. “… tsk…!” El cuerpo de Shirase fue robado de
libertad, solo con eso. Ella no podía mover su cuerpo.
es… hackeo, es así… Supongo que esto es el poder que ella menciono…
Ella no pudo resistir del todo. La otra
parte probablemente no vacilaría en remover cualquier obstáculo.
Si ese fue el caso, entonces podría ella
terminar muerta. Sin embargo, Shirase estaba calmada… Porque ella tenía un
“Podría confirmar una vez más antes que
el fin llegue, ¿estás bien con eso?”
“Si, adelante.”
“¿No tienes la intención de arreglar la
grieta entre tú y tu hija?”
“No hay manera. Ya vivo libremente.
Rechazo la noción de volverme íntima con mi chiquilla.”
“¿Estas en verdad bien con eso?”
“¿No es eso obvio? No me hagas repetir
lo mismo. Ese tipo de chicas estúpida… de hecho, ¿ve? Estos chicos son chicos
buenos. Ellos propiamente escuchan lo que digo, tales chicos buenos. ¿No son
hijos asombrosos? Siempre quise tener niños como estos.”
“Que madre podría convertir a sus niños
en muebles… no, es inútil decir cualquier cosa a ti.”
“Si eso es correcto. Así que puedes
dejarme sola ya. Adiós.”
La Reina de La Noche ligeramente sacude
sus dedos. Una onda de choque se dispersó de esa punta del dedo, y disparo a la
vez… Shirase fue fácilmente arrojada y estrellándose contra un árbol. *Prick.*
Calmadamente mirando a la rama que
perforo desde su espalda, Shirase cerró sus ojos.
El plan para neutralizar a la reina
desde fuera del juego termino en falla.
Sin embargo, esto no había terminado. La
esperanza aún estaba ahí, dentro del juego.
“La próxima vez que abra los ojos, ese
confiable par de madre e hijo probablemente estén aquí…”
Y con su poder, ellos podrían sin duda
guiar todo esto en la dirección correcta.
Sosteniendo tal premonición en su pecho,
Shirase fue puesta en un ataúd.
[1] Belleza de estilo – Una expresión de
la antiestética de un estilo, puede ser usada en arte y artesanía, y también
describe la forma estética de un plan/programa.
[2] Pettanko – Un apodo japonés dicho
para una chica con pechos planos.

[3] Bishounen – Hombres de aspecto joven
y hermoso.

Okaa-san Capitulo 4 (Parte 1)

Capitulo 4: Él nunca pensó una vez que tener una madre entendiendo fuera bueno
El cielo que ellos veían era soleado,
sin una sola pizca de nubes. Gentil brisa golpeaba a veces frotando contra sus
espaldas. Fue momento para avanzar.
Fue un genial día para comenzar un viaje
y buscar aventuras.
“¡Muy bien entonces, vamos a irnos!
¡Todo el mundo, sígame!”
“¡Si! ¡Estoy lista en cualquier
Siguiendo ese energético comando, el
equipo dejo el Pueblo Kassan.
Ellos fueron avanzando a través de los
pastizales con pasos ligeros… Excepto el hecho que dos de ellas eran ligeras.
“¡Escuchen, estaba pensando sobre esto!
¿Qué hay sobre hacer una carrera a nuestro destino o algo así?”
“¡Si! ¡Yo lo hare!”
“¡Muy bien, vamos a hacerlo! ¡La persona
que llegue al bosque primero recibirá un presente lleno con lujosas
“¡Si! ¡Quiero lujosas recompensas!”
Ahí estaba una Sabio JK vistiendo una
chaqueta carmesí y una Mercante Viajera abrazando una gran bolsa de hombro.
Aquellas dos corrian íntimamente juntas, silbando melodías mientras pasaban
junto al camino, y haciendo muecas *kya kya* como estaban charlando. Un jardín
de flores de dos.
¿Qué diablos están haciendo?
“Haa… oi Wise, e incluso Porta también.
¿Solo que pasa? ¿No son ustedes dos inusualmente animadas?”
“E-Erm… eso es…”
“Hmm~? Eso es
Respondiendo la llamada de Masato, Wise
decidió hacer un giro y volteo alrededor, con una sonrisa floreciendo en su
Justo cuando él intento entender lo que
ella estaba haciendo, ella repentinamente se acerco al rostro de Masato y tomo
su ropa del pecho, entonces mirada como dagas lo perforaron furiosamente como
si ella estuviera apuñalándolo. ¡Qué intensa mirada! ¿¡Quien en esta persona de
“E-Erm… Wise-san…?”
“¿Ya vez, Masato? ¿Acaso no entiendes
porque nos sentimos de esta manera? Hey, ¿no lo tienes? Gracias a alguien, la
atmosfera del equipo fue nublado y arruinado. ¿Acaso no comprendes nuestros
esfuerzos para desesperadamente intentar e iluminar el humor? Hey, ¿no lo
“Uu… l-lo siento…”
“En verdad no necesitas disculparte. ¿No
hay algo que deberías estar haciendo ya que eres  el responsable? ¿Qué hay sobre eso? Hey, ¿Qué
hay sobre eso?”
“S-Sí… También creo que necesito hacer
algo ya que soy el responsable de esto, por favor perdóname…”
“Entonces apúrate y hazlo. Vamos.”
Siendo empujado de su pecho, él se
retiró cinco pasos atrás.
Masato se alineo con Mamako que estaba
al lado de él.
“Ah. ¿Qué sucede, Maa-kun?”
“¿Eh? Ah, erm….”
Mamako, que vestia una armadura ligera
sobre su vestido de una pieza, usa su voz usual para llamarlo a él con su tono
Sin embargo, su expresión era de alguna
forma reservada. Su abrumadora felicidad juvenil aun restaba, pero parece como
si hubiera rastros de enfermedad, para ella mostrar una ligera sonrisa nublada…
Era innecesario decir cuál era la razón de eso.
Para regresar a ese brillo como la luz
del sol que fue actualmente cubierta por una nube. Esa fue la misión actual de
“Tú, vez… eso… sobre mi equipamiento…”
Como él intentaba hablar del tema,
Mamako repentinamente mostro un rostro frustrado, bajando su cabeza en pánico.
“¡Lo siento! ¡Mama en verdad lo siente!
¿¡Cómo debería mama disculparse!?”
“¡No, no tienes que disculparte! ¡Está
bien ya! ¡Ese asunto ya fue arreglado después del buen remedio de Porta! ¡Esto
se siente bastante bien!”
El equipo que Masato estaba equipando
actualmente era conocido como [Chaqueta Armadura].
Usando la arruinada chaqueta y las
hombreras y guanteletes parte de la armadura, combinados, fue rehecha en una
armadura ligera. Fue un producto de la habilidad de Creación de Objetos de
Como resultado de la combinación, la
completa inmunidad contra estados anormales fue disminuida, la
auto-recuperación y resistencia contra alientos fueron reducidas. Esa parte fue
un poco lamentable.
Sin embargo, las funciones de ayuda
fueron combinadas, el diseño fue también no tan malo, más importante, él estaba
feliz que fue hecho a mano por Porta.
por eso, ya no tienes que preocuparte sobre esto ya…
Calmado por la situación actual después
de ir a través de giros y vueltas, Estoy
agradecido que tomo este camino…
él estaba intentando ir junto con este
flujo, pero….
“Mama en verdad lo siente. Mama no para
de hacer cosas por su propia razón. Mama no se entrometerá en el camino de
Maa-kun. Es por eso, mama te lo implora… no odies a mama, ¿okay?”
Mamako estaba completamente histérica.
Ella estaba llena de disculpas. Una actitud de disculpas como pared de hierro.
Ella no estaba escuchando nada de lo que él decía.
La retirada de Masato no era elección… o
al menos, él quería, pero “¡No escapes! ¡Garrr!” él fue arrinconado por Wise,
que estaba caminando en el frente, y se empujado atrás. Él regreso al lado de
“Ah… erm… uh mira…”
“Lo siento. Mama en verdad lo siente.
Mama no hara nada nunca más. De esa manera Maa-kun no se enojara, ¿correcto?”
“Eso es… no, no es sobre eso… no hacer
nada no está bien…”
“¡Aa, es correcto! ¡Roles! ¡El asunto
importante que tenía que hablar es sobre roles!”
“En este tipo de juegos, todo el mundo
juega su propio rol, hacer su trabajo propiamente, y venir juntos como un
equipo. Como un resultado de jugar diferentes roles, la confianza nace y
también comienzas a pensar que quieres ser más íntimo como un equipo también.
Así que.”
“Jugar un rol es importante… entonces
que rol debería mama ser… ¿a cargo de comidas? ¿Lavar después de eso? Ah,
atender a las reuniones de guardianes es también el rol de mama.”
“Muy bien, cálmate, primero necesitas
dejar lejos esto de la realidad y pensar en términos de juegos básicamente.”
“Ah, ¡e-eso es verdad! ¡Nosotros estamos
actualmente en un juego!”
“Es por eso.”
Por el momento, ¿había algún rol
adecuado para Mamako?
Había. Justo el rol perfecto.
“Hablando de eso, mama está sosteniendo
ese libro guía, ¿correcto? A pesar de eso, el mapa del Bosque Perdido al que
nos estamos dirigiendo está guardado dentro, ¿cierto?”
“Mapu… aah, estás hablando sobre mapa.
Si, está grabado. Mama ha propiamente revisado. Mama ha apuntado la página así
ella puede revisarla inmediatamente.”
“Muy bien, muy bien. Por esa razón, por
el momento, el rol de mama va a ser guiarnos. Vamos a pasar a través del
bosque, que tiene una reputación de hacer a la gente perderse dentro, y
llegaremos a la villa localizada dentro. Libre para jugar un rol bastante
activo. Estoy dependiendo de ti.”
“¡Si! ¡Mama jugara su rol propiamente!
¡Mama trabajara duro! *¡Shine!*”
“¡Muy bien, ese es el espíritu! ¡Vamos a
ir en humor brillante!”
El sol en el cielo y el rostro sonriente
de Mamako después de recuperar su motivación. Si hablan sobre cuál era más
cegador, debería ser Mamako por un pequeño margen. Él secretamente tenia tal
pensamiento vergonzoso mientras mantenía un rostro serio.
¿Por qué uno se pierde en ese bosque?
Había dos razones.
Uno era debido a los incontables caminos
que podría no ser diferenciados, como rastros de humanos o bestias fueron
revueltas juntos.
La otra era como los árboles crecían.
Debido a la carencia de características especiales y crecimiento de patrón
idéntico con la misma densidad, un escenario similar podría mostrarse cuando
mires hacia la izquierda o derecha. Es por esa razón que era llamado Bosque Perdido,
donde la gente fácilmente se perdía.
Mamako lidero el grupo y dio un paso
dentro del Bosque Perdido primero.
Y entonces, ellos rodaron y rodaron
cerca de treinta veces de vuelta a la entrada.
Es más como [Hemos regresado a la
entrada antes de incluso notarlo] para ser preciso.
“¡Haha! ¡Estamos totalmente perdidos!
¿¡Que hay sobre esto, mama!?”
“Aunque mama propiamente siguió el
camino escrito en el libro guía y avanzo… ¡Maa-kun! ¡Por favor dale a mama una
oportunidad más! ¡Mama completara su rol!”
“Creeré en aquellas palabras… Entonces,
vamos a movernos.”
Ellos se mueven a la entrada del bosque.
Primero, ellos fueron derecho. “Después de pasar el arbusto en frente, va a la
derecha” Ellos lo pasaron y giraron a la derecha. “Luego es izquierda” Ellos
giraron a la izquierda y siguieron un rastro de bestia “Camina derecho justo
como eso” cruzaron sobre un tronco caído “Izquierda” pasando a través entre
rocas como pilares, y entonces…
Ellos llegaron a la entrada. Estoy de vuelta. Bienvenido de regreso.
“Oi… no puedes incluso guiarnos el
camino huh…”
“¡L-lo siento! ¡Mama en verdad lo
“Ah… ah, no… no tienes que disculparte
por eso…”
Mamako sobre reacciono a los murmullos
de Masato, desesperadamente inclinando su cabeza… Lo hice de nuevo. Aunque Masato debería haber sido más precavido de
si mismo.
Tomando el libro guía de Mamako que se
deprimia de nuevo, Masato reviso solo para estar seguros. El mapa dibujado no
era diferente de este Bosque Perdido, la guía de Mamako parece ser aproximada
de acuerdo a la explicación.
A pesar de eso, no ser capaz de ir a
través del bosque era…
“¿Tal vez un objeto especial es
necesario? ¿O es este un evento?… No, entonces podría haber sido escrito
aquí… ¿entonces podría ser un bug?… Ah geez… inútil…”
“L-lo siento… por ser una mama inútil…”
“¡No, te equivocas! ¡No hablaba de ti
cuando dije eso justo ahora!”
Él siguió en pánico, pero la deprimida
Mamako ni incluso levanto su rostro.
Y, el cabello en la región occipital de
Masato fue *¡beshi!* repentinamente jalado.
“Ouch… q-que estas…”
Había solo una persona que podría hacer
esto. Dio la vuelta, y fue de hecho Wise.
Sin embargo, Wise no dijo nada, y jalo a
Porta lejos, que estaba junto con ella, justo en frente de Masato. Aquellas
pupilas puras, estando muy tristes, estaban mirando a Masato. *Mirada. Mirada.*
“¡Y-ya entendí! ¡Hare algo al respecto!
Él dijo eso, ¿ahora que debería hacer?
Él no podía pensar en nada del todo…
En ese momento.
“… Um, ¿Maa-kun? ¿Puede mama tener un
poco de tu tiempo?”
Mamako le llamo en una manera reservada.
Y entonces, Mamako se sentó en seiza en el medio de un punto donde la luz del
sol carecía a través del dosel de árboles, mirándolo a él mientras golpeaba sus
“… ¿Si?”
¿Qué tenía pensado hacer exactamente?
Como Masato inclino su cabeza en pregunta, Mamako apunto a la rama al lado de
ella. Dos aves salvajes estaban ahí. Estaban piando, pero…
Ah, sí sí, eso es lo que significa.
Masato inmediatamente entendió lo que su
madre estaba diciendo. Sin embargo.
“Umm, mama. Eso es un no.”
“¿E-es eso así? Mama pensó que tal vez
inesperadamente funcione… como esperaba, no es posible.”
“Detente. No se comuniquen en una manera
donde solo mama e hijo puedan entender. Explíquenlo a nosotras también. ¿Qué significa
Wise dio voz a su insatisfacción. Porta
también parecía mirar aquí con gran interés.
Él tenía que explicar aquí.
“Honestamente hablando, esto es solo
alguna charla estúpida… cuando era un chiquillo, en verdad odiaba limpiar mis
oídos. Porque me da cosquillas. Entonces mama me dijo esto.”
“Mama dijo ‘Después de que limpies tus
oídos en la almohada regazo de mama, serás capaz de escuchar las voces de los
animales’. Entonces Maa-kun fue capaz de disfrutar la limpieza… Ufufu, es
nostálgico. La última vez fue hace cerca de una semana, probablemente.”
“¡Eso fue hace más de diez años! ¡Note
que fue una mentira antes de ir a la escuela elemental!”
“En verdad no me importa si fue hace una
semana o hace un día. ¿Así que hay sobre eso?”
“En otras palabras, si consigo limpiar
mis oídos en la almohada regazo de mama, tal vez sea capaz de escuchar las
voces de aquellas aves silvestres, que podrían posiblemente darnos una pista
para pasar a través de este bosque, ese tipo de cosa estúpida es lo que está
pensando. Es sobre eso, ¿correcto?”
“Eso es correcto. Sería genial si
podríamos hacer eso… Porque, mama puede hacer su cuerpo resplandecer, ¿sabes?
Es por eso, tal vez, es como, es como mama piensa…”
“Entiendo que las madres son capaces de
liberar increíbles habilidades. Pero solo sé que eso no va a pasar. Eso es solo
demasiado irrazonable.”
“E-eso es verdad… lo siento por decir
cosas irrazonables…”
“Uu… ah, no, ya lo he dicho muchas veces
que no tienes que disculparte…”
Mamako se sumergió en depresión.
Mamako probablemente pensó
desesperadamente sobre que ella podría hacer. Aunque probablemente intento lo
mejor para recuperar su honor… Masato inmediatamente se negó a eso. Su corazón
estaba adolorido.
Mientras tanto, la espalda de Masato fue
golpeada. Fue de hecho Wise y Porta que estaban ahí cuando giro atrás Ojos
llenos con condenación y también ojos llenos con tristeza lo miraban. Miradas
sin palabras. Tal presión en su espalda.
Él no tenía elección sino hacerlo aquí.
“Ah, escúchame, mama. ¿Puedo tener un
Masato se acostó en la almohada regazo
de Mamako. Su mejilla presiono en aquellas suaves medias como ligeramente cerro
sus ojos.
“Erm… ¿Maa-kun?”
“¿Intentarlo está bien cierto? Es por
eso, aquí, apúrate y limpia mis oídos.”
“¡E-eso es cierto! ¡Okay!… Porta-chan,
puedes pasarme mi equipaje ¿por favor?”
“¡Sí, aquí tiene!”
“Y yo te estare mirando. Estare
cuidadosamente observando el rostro del chico que abiertamente se acuesta en la
almohada regazo de su madre y sus oídos siendo limpiados. Kukuku.”
“¡Te lo imploro, por favor ve a algún
lado! ¡Te lo ruego!”
Su apariencia por la vergüenza fue
mostrada, pero podría resistir esto esta vez. Resistir.
“Entonces, Maa-kun. No te vayas a mover,
Como escucho la risa juvenil de Mamako,
la punta de un limpia oídos entro a su oído.
Un sentimiento sólido, pero calmado y
gentil, rascado aquí y allá, haciendo cosquillas. Masato en verdad odiaba este
sentimiento. Incluso ahora, no podría decir que le gustara esto.
Sin embargo, directamente opuesto al
oído siendo rascado, le gustaba el sentimiento de su mejilla presionando en la
almohada regazo. Tan suave. Tan cálida. Su posición era un poco alta, causando
algún malestar en su cuello. Sin embargo, era confortable sin razón.
Y él francamente pensó.
“Es el regazo de mama, huh.”
“Eso es correcto. Es porque este es el
regazo de mama.”
Él estaba bastante avergonzado sobre
dejar salir su voz sin pensarlo.
Aun así, esa almohada regazo fue contra
las reglas. La almohada normal podría sentirse mejor si simplemente consideraba
poner su cabeza en esta. Sin embargo, esta almohada regazo fue envuelta con un
absoluto sentimiento de satisfacción, una cosa especial que definitivamente no
podría sentir en otra cosa más.
Podía solo ser esa almohada regazo…
Podría solo ser la almohada regazo de madre, él confirmo que fue algo especial.
Algo que podría incluso hacer un corazón
molesto a abrirse.
que decir esto propiamente en esta ocasión. Esta es una oportunidad.
Masato tenía que decirle a Mamako. Él
sintió que podría decir esto ahora.
“…Hey, mama.”
“¿Qué pasa?”
“Lo siento sobre varias cosas. Parece
que he dicho mucho, ya que la otra parte es mama… en verdad lo siento por
hacerte sentir mal. Esto es mi culpa.”
“Sobre mama, nunca he pensado que fueras
una inútil o una molestia. Tú eres muy útil… eso parece ser una mala manera de
ponerlo… tú eres muy confiable. Incluso ahora, aún no puedo limpiar mis propios
oídos, así que eres de gran ayuda.”
“Oh mí. ¿Es mama un agente de limpieza
de oído? ¿Es este el rol de mama?”
“¡No! ¡No no! Eso no es lo que quiero
Como estaba entrando en pánico y
refutando, “Hey. No te muevas” una gentil mano presiono atrás de su cabeza. Esa
mano comenzó a acariciar su cabeza justo como eso. De nuevo y de nuevo,
Como Mamako estaba haciendo eso.
“Tú sabes, a mama en verdad le gusta el
Maa-kun que es gentil y mira por su mama.” *Shine.*
“Gracias… más importante, mama me estas
Luz llena con felicidad estaba desbordando.
Masato cerro sus ojos como si escapara de ese deslumbro.
Su inmensa vergüenza de lado junto con
su consciencia de él cayendo dormida…
Cuando Masato se levantó de la almohada
regazo de su madre, ya estaba inmensamente avergonzado quemándolo y sintiendo
como si fuera a morir.
“N-no lo malentiendan, ¿¡okay!? ¡Ese es
el efecto de la almohada regazo de mama! Una habilidad especial que te hace
caer dormido en su regazo…!”
“Si, si, continua diciendo eso.
Conseguiste una siesta en el regazo de mama, bien por ti.”
“Kuh… estoy seriamente lamentándolo
“¡Pero creo que ser capaz de escuchar
las voces de las aves por limpiar los oídos es asombroso! ¡Gracias a eso,
podemos pasar a través del bosque!”
“Umu. También estoy impresionado. Pensar
que en verdad soy capaz de escucharlos… mama es asombrosa. Esa habilidad es
“¡Mama es muy feliz de que digas eso!
¡Mama se siente mucho mejor!” *¡Shine!*
El piar de las aves volando sobre sus
cabezas se volvieron palabras como Masato las escuchaba.
“Ve arriba, arriba, ve abajo, abajo” “Ve
izquierda, ve derecha, ve izquierda, ve derecha” Él ciertamente escucho
aquellos piar continuamente. [TLN: Movimiento secreto: Código Konami]
Aunque ellos podrían regresar a la
entrada si ellos seguían aquellas instrucciones…
Dejando de lado el arbusto, él no
encontró la entrada. Era tan largo solo un bosque. Hostiles árboles que tienen
espinas creciendo en ramas y troncos al azar creciendo a donde quiera que
miraran como un suelo interrogatorio de espinas.
Ahí, él vio la figura de una persona.
Mirando de cercas, ella parece ser la Misteriosa Monja Shira.
“¡Ah! ¡Queridos viajeros! ¡Ahora, vengan
aquí! ¡Vamos a tener algo bueno juntos! ¡Está bien, no hay tales cosas como
trampas aquí del todo! ¡Ufufu! ¡Ahaha!”
La Shirase de pie ahí estaba mostrando
un raro rostro sonriente, justo como una figura falsa de santidad forjada por
una tienda no oficial de recuerdos, sacudiendo sus manos y cuerpo como un
títere siendo controlado, haciendo una pose que dice ‘vengan, vuelen dentro de
mis pétalos’.
Más allá de ser impactados, era al menos
admirable la baja calidad que era.
“No hay necesidad de sospechar en donde
es sospechosa o no, esto es una trampa.”
“Aunque esta no es la primera vez que
nos encontramos uno al otro, ella aún dijo, ‘¡Queridos Viajeros!’ Su actitud es
totalmente diferente. Eso es completamente roto.”
“U-um… de acuerdo a mis ojos, parece
haber algo como una raíz de árbol apuñalando la espalda de Shirase-san… parece
ser que erosiona su cuerpo entero desde ahí…”
“¡Oh no! ¡Si no la ayudamos a ella
Y entonces, Mamako repentinamente
corrió, pero se detuvo cuando repentinamente lo noto.
Ella miro a Masato y hablo de nuevo.
“¡Oh no! ¡Si no la ayudamos a ella
“Ah, un. Estas entregando el rol para
correr primero a mi… Hmm, pero ya vez… esta es una trampa obvia…”
“Entonces yo iré. Solo vete a dormir en
el regazo de tu mama. Pupu.”
“Oh. ¿Es eso así? Entonces Maa-kun,
bienvenido.” Ella se sentó en seiza y limpio su regazo.
“¡No vayas a esperar!… ¡Ah, oi, Wise!”
Wise se movio primero con su espalda
hacia ellos. Ella camino hacia Shirase, que era obviamente de aspecto extraño,
agarrando su mano, en ese instante.
*¡Omnf!* Ellos fueron tragados.
“… ¿Hah?… Oi, es en serio…?”
Comidos… con un área del suelo, el
equipo entero fue comido junto con el lugar entero en sí.
La verdadera identidad de la trampa era
el lugar a donde el grupo de Masato había llegado. Ese fue justo como un enorme
hoyo. Al instante cuando la presa toca la carnada, que actúa como un gatillo,
podrá cerrarse como una trampa.
El suelo alrededor del grupo de Masato
fue desplegado en dos, y como si masticada, arboles espinosos comenzaron a
tocarse unos contra otros.
“Hmm. ¡Como esperaba esto podría pasar!
¡Justo como lo que había leido!” *¡Ehen!*
“Entonces ten cuidado de esto antes de
activar la trampa. Geez… ahora bien, mama.”
“¡Vamos!… Es lo que mama quiere decir,
pero… mama parece ser incapaz de levantarse.”
Tal vez ella fue herida. Como estaba poniéndose
ansioso “… Funya…” Porta estaba durmiendo en la almohada regazo de Mamako en
lugar de Masato. “¡Mira, Wise! ¡Ve! ¡Ve!” “¡Si si, ya lo tengo!”
La almohada regazo de Mama tiene un
efecto de inducir somnolencia.
“Como encariñar este tipo de situación…
¡pero buen trabajo Porta! ¡Si mama no se puede mover!”
“¡Sera siempre nuestro turno desde aquí
en adelante! ¡Vamos a hacerlo, Masato!”
“¡De acuerdo! ¡Entonces, vamos!”
Uno estaba en el dedo medio izquierdo de
Masato. El otro estaba en el dedo medio derecho de Wise. Anillos Aderire, quien
sea que los use se ajusta a su tamaño, estaba brillando como su efecto fue
El ataque combo ha comenzado.
Mientras tanto, Masato estaba sosteniendo
a Firmament, pero “… ¿A dónde exactamente debería atacar?” “¡Yo también quiero
saber eso!” El suelo desplegado. Los árboles rechinando. Ellos podrían solo
atacar todo por el momento.
“¡Perdóname Madre Tierra! ¡Perdónenme
árboles! ¡L siento por ser un héroe que no es eco amigable!… ¡Wise,
“¡OK! ¡Cast Cancel! ¡Bomba・Sfera (Bola
Explosiva)! ¡Además! ¡Fuoco・Fiamma (Infierno)!”
Añadido al tajo de Masato, la magia de
Wise siguió. Ellos cortaron, destrozaron, y quemaron sus alrededores “¡Espera
hasta que mi poder de acción se recupere!” “¡Apúrate!” Después de un rato de
descanso “¡Muy bien, vamos!” “¡Ok! ¡Cast Cancel!” Ellos cortaron, destrozaron,
y quemaron.
Ellos intentaron atacar al azar como
eso, pero dejando de lado la activación combo, no parecía haber respuesta.
La gran boca del suelo continuaba masticando
sin verse afectada, el grupo de Masato parecía cercano a ser triturado.
“¡Po esto es malo! ¡Si esto continua
como tal, en verdad vamos a ser comidos!”
“¡Ya se eso! ¿¡Entonces que deberíamos
hacer!? ¡Atacar los alrededores no parece tener algún uso! El único lugar que
no hemos atacado es… solo Shirase-san…”
“S-si. Shirase-san es claramente el
punto clave…”
Accidentalmente fue una cosa, pero
atacarla directamente era un poco… mientras tanto.
“¿Uh? ¿Dónde está Shirase-san?”
Cuando ellos giraron hacia ella, la
figura de Shirase no estaba ahí. ¿A dónde fue Shirase?
“… Zzz…”
Ahí. Shirase estaba justo al lado de
Mamako. En el lado opuesto de Porta que estaba durmiendo en la almohada regazo
de Mamako, Shirase estaba también en profundo sueño usando el regazo como
almohada. “Oi” de paso, el monstruo raíz parasito en su espalda estaba
durmiendo junto con ellas.
“Esto… ¿no me digas que es una nueva
habilidad de mama?”
Mamako había aprendido la habilidad de
Regazo de Madre】que podría ciertamente hacer a un máximo de dos objetivos caer
dormidos, sin importar si era un enemigo o un aliado, en intercambio de ella
caer dormida también.
“Para hacer a un monstruo nivel jefe
caer dormido… la almohada regazo de mama es de miedo.”
“¡Esta es nuestra oportunidad! ¡La raíz
parasito en Shirase-san es más como el cuerpo principal! ¡El oponente no se
puede resistir mientras duerme, los dos podemos cortarlo y quemarlo hasta el
“No digas eso en ESA manera… no nos hace
ver como si estuviéramos haciendo algo terrible…”
“L-lo siento…”
Sin embargo, que ellos de hecho iban a
hacer justo con eso. [*Nota: ¡El oponente es un monstruo!] Masato cortó al azar
al indefenso, oponente durmiendo. [*Nota: ¡El oponente es un monstruo!] Wise
uso Chainspell para quemar al oponente que no podía resistir de raíz. Aquellos
dos solo fueron considerados de palabra al comienzo, pero sus furiosos ataques
“¡Masato! ¡Termínalo!”
“¡Déjamelo a miiiiiiii!”
La punta de la Espada Sagrada del Cielo
Firmament perforo profundamente en la raíz en la espalda de Shirase, la
victoria fue decidida. ¡Raíz Demonio derrotada!
El amplio campo fuera de la Raíz Demonio
se marchito. El campo transformado regreso al normal, y el cuerpo de Shirase
fue liberado de ser un rehén. “¿Ella parece estar quemada en algunos lugares?”
[*Nota: Ella ya estaba muerta al momento que se volvió un rehén. No es mi
culpa] No penalidad.
Y entonces, el resultado de la victoria
fue mostrado. Al mismo tiempo con el informe de subir de nivel *¡popopopon!*
saltaron continuamente.
“Muy bien, bueno. Un gran aumento en
subir niveles, una gran cantidad de SP conseguidos. Parece que puedo aprender
algunas buenas habilidades… Hmm… esa batalla dio una en verdad mala impresión,
¡pero propiamente doy consideración y ganamos! ¡Esta es nuestra victoria! ¡Esa,
es nuestra real habilidad!”
“Eso es cierto. Aunque Mamako-san ha
colocado la mesa, ciertamente nuestro poder es eso… más bien, Masato ataco una
vez, yo ataque doble, así que dos tercios de eso es gracias a mí, ¿correcto?”
“N-no digas ese tipo de cosas… aunque
conseguí estar de buen humor después de tanto problema…”
“Si, si, lo siento, lo siento. Ahora
bien… aquí. ¿Quieres hacer esto?”
Wise empujo su puño. Esto fue ‘eso’ que
ha sido interrumpido varias veces. Por supuesto él iba a hacer esto. En
celebración de su victoria, sus puños chocaron uno contra el otro.
Y entonces…
*Hyaahho* *¡Yay!* y así. La persona que
estaba observando sobre aquellos chicos animados después de su victoria estaba
“… el rol de mama, quizás es este tipo
de cosas.”

Mamako murmuro, y cerró sus ojos de

Okaa-san Capitulo 3 (Parte 4)

Capitulo 3: La ropa interior es protectora. El área defensiva tal vez sea grande. ¡De otro modo el hijo morirá!
Con eso, las cortinas fueron grandemente
bajadas. Mamako, Wise, Porta, con las tres féminas de tres generaciones, el
Show Fashion RPG comenzó.
“Déjeme recordarle solo en caso, si un
sangrado nasal o cualquier otro fluido que salga por nuestros queridos clientes
ensucia cualquiera de los equipos, usted es obligado a comprarlos, por favor
sea cuidadoso.”
“No tendré un sangrado nasal… O más
bien, que quieres decir con otro fluido…”
“¿Está bien si lo digo contundentemente?”
“… No, por favor detenga eso.”
“Lo es cierto. Entonces sin añadir más,
vamos a darles la bienvenida. ¡Por favor!”
Las cortinas de aquellos cambiadores que
la tienda tenía preparado fueron levantadas, apareciendo detrás estaba…

“¡Maa-kun! ¿¡Como piensas sobre mama en
¡Mamako equipada con la Armadura Bikini!
Que define una armadura protectora… esa
Armadura Bikini forzaba tal pensamiento filosófico, pero Mamako vistiéndolo era
un asunto serio.
La armadura del pecho no cubría incluso
un quinto de sus esplendidos pechos. Ellos parecían como si estuvieran a punto
de estallar cada vez que se balanceaban. Una delgada cintura, estomago plano, y
un breve mínimo triangulo inverso debajo de eso. Era ya al punto donde podría
ver su piel a donde sea que mirara.
[K: Soy solo yo, o todos queríamos una
imagen en este lugar… en serio, que le pasa al ilustrador… haz tu trabajo…]
Y Masato abrazo su cabeza. Su fuerza de
agarre estaba cercas a destrozar su propio cráneo.
“… Nadie lo sabe… el corazón de un hijo
que ve a su madre vistiendo una Armadura Bikini, nadie lo entiende excepto yo…”
“¿O-Oh? Mama pensó que Maa-kun podría
estar feliz sin embargo… quizás no es adecuado para mama.”
“¡Si estás hablando sobre adecuado o no,
no puedo decir que sea malo del todo! ¡Pero ahí es más un problema fundamental!
¡Solo quítate eso ya!”
“M-muy bien, lo tengo. Entonces mama va
a cambiarse al siguiente.”
“Quiero decir, ¿¡ponte tus ropas
Mamako entro de vuelta al cambiador. Él
se preguntaba qué tipo de cosa peligrosa podría ser después.
Sin embargo, antes de eso.
“¡Las siguientes son las dos jóvenes
“¡Ooh! ¡Eso es cierto, aún tenemos a
estas dos alrededor! ¡Festín para los ojos, vengan! ¡Por favor sanen mi
Las siguientes en mostrarse fueron Wise
y Porta.
“¡Fufu! ¡Mi cadena de magia blanca
sanara ambos, tu cuerpo y corazón!… Solo bromeaba.”
“¡Te hare objetos! ¡Hare tantos de
ellos!” [TLN: Ha hecho más de cientos de objetos, aunque dichas manos nunca
sostienen alguno.]
Wise apareció en equipamiento para mago blanco.
Vistiendo una túnica de blanco puro con un patrón dibujado de formación de
hechizo, ella aparece con una sonrisa gentil. Ella fue justo como un ángel… eso
tal vez sea demasiado que decir.
Porta fue en estilo Item Meiste (Maestro
de Objetos). Sus ropas parecen como un erudito, con un sombrero de erudito
encima de su cabeza, y un par de pequeños lentes en su nariz. Una linda
Mirando alternativamente a las dos,
Masato suspiro en alivio.
“Umu. Había esperado este tipo de cosas.
Creo que esto es más o menos la manera correcta.”
“Fufuh, ¿lo sabes cierto? Actuar como
esto no es malo una vez al menos. Más bien, mi lado puro está elevándose. Tal
vez incluso incremente el número de mis creyentes. Ehee.”
“Qué desvergonzada.”, él dijo
“¿¡No digas eso con un rostro serio!?
¡Solo estoy bromeando!”
“Porta es una perfecta chica linda~ Dejarme
darte una caricia~ Uhehe~”
“¡E-es cosquilloso!”
“Querido cliente, tendrá que comprar el
equipo si usted lo ensucia con su baba.”
Oh eso estuvo cercas. Él succiono de
vuelta ese otro líquido.
“Muy bien, eso es todo. Entonces todo el
mundo regrese a sus equipamientos originales y vamos a retirarnos de aquí…”
“¡Espera Maa-kun! ¿¡Qué piensas sobre
mama en esto!?”
“¿¡Por todos los medios, por favor no
vengas fuera!?”
Aparición de Mamako ronda dos. Las
cortinas del cambiador fueron enérgicamente levantadas, lo que apareció detrás

[K: Y con esto sí… ¿en serio?… aunque no
está mal… levante la mano los fetichistas de trajes escolares…]

“Oosuki Mamako, quince años. Ehe☆ Solo
Era Mamako en estilo JK. Encima era un
uniforme de chaqueta. Debajo estaba una falda super corta. ¡Sus pechos
demasiado esplendidos hicieron a los botones de la blusa parecer que fueran a
saltar fuera en cualquier segundo! ¡Él pudo también echar una mirada breve a
sus pantis!
Y Masato abrazo su cabeza, queriendo
arrojarla lejos de aquí.
“Mi madre está haciendo cosplay JK… pero
su área del rostro y cuerpo son todos tan jóvenes que no hay asunto de
compatibilidad… como podría esto sin sentimiento confundidos en palabras… más
importante, porque un uniforme JK…”
“¡Aah! ¡Lo siento por la inconveniencia,
querido cliente! ¡Eso es solo para uso de eventos, así que no está a la venta,
por favor perdóneme!”
“Ah, ¿es eso así? Lo siento. Mamako es
en verdad descuidad. Kyaha☆”
“¡Para eso yaaaaaaaa! ¡Te lo imploro,
por favor vuélvete a cambiaarrrrrr!”
“Ok. Entonces el siguiente.”
“¡No esooooo!”
La apelación de Masato fue en vano,
Mamako regreso al cambiador… ella rápidamente se cambió y se mostró de nuevo.
Esa figura fue…
“Mama ha decidido… con este poder de
oscuridad, mama exterminara cualquier cosa.”
Dios Demonio, no, ella debería ser
llamada Diosa Demonio. Vistiendo una armadura negro azabache quemando con
llamas negras del infierno, mirando al frente con pupilas desprovistas de luz,
Mamako que se había vuelto una encarnación de poder negativo dio un paso al
Una madre corrompida por la oscuridad.
Masato estaba sin habla, él podía solo
mirar su figura en blanco.
“¿O-Oh? Maa-kun, ¿Qué paso? ¿Acaso mama
se ve extraña de alguna forma?”
“¿Eh? Ah, no…”
Tal vez era inesperadamente bueno, ese
tipo de pensamientos fue un secreto.
“¡E-Err mira! ¡Eso no es en verdad malo!
¡Un, no es malo! ¡Hay menos exposición de piel, así que tu hijo puede verte
directamente sin preocuparse! ¡Esta de super miedo a pesar!”
“Oh, ¿es eso así? Es genial que a
Maa-kun le guste. Entonces el siguiente es…”
“¡No, está bien! ¡Ya es suficiente!”
“No digas eso, solo una más… Viendo a
Wise-chan vistiéndolo, mama también pensó en querer intentar usarlo un poco…
Vez, es esto.”
Como ella dijo así, Mamako mostro esa
túnica blanca que iba a vestir después, pero… espera un momento.
“La misma como Wise ¿huh? Pero eso
significa… ¿Qué hay sobre esto Porta?”
“¡Si! ¡Este producto es una túnica de
curación, un equipamiento principalmente para sanadores y Profesiones Mágicas!”
“Mi Sabio es una Profesión Mágica así
que es OK, pero para Mamako-san es imposible.”
“¡Si! La profesión de Mama-san es Madre
de Héroe, así que posiblemente equipamiento para Profesión de Guerrero justo
como el héroe, desafortunadamente, eso no es equiparle.”
Es de esa forma, pero.
Mamako no podía comprender eso, así que
ella estaba sosteniendo la túnica en sus manos cerca de ella tan posible para
“¿Pero mira? Aquí, el tamaño de los
hombres es el correcto. El tamaño debería estar bien, ¿cierto?”
“No, ¿ya vez? No es sobre el tamaño, tú
profesión no te permite vestirlo…”
“La profesión no es en verdad un
problema. Ya que son ropas. El tamaño determina cuando puedes vestirlo o no.”
“No, ¿uh mama? Normalmente hablando ese
es el caso, pero en un juego…”
“Esta bien. Mama lo intentara por un
Sin embargo, ella no entendió incluso un
fragmento de que estaba mal. Mamako rápidamente entro al cambiador. Entonces,
sonidos de cambiarse podrían escucharse.
“Erm… si tú forzosamente vistes un
equipamiento mientras ignoras la restricción, ¿Qué ira a pasar?”
“E-eso es… También no lo sé.”
“Hey tendera. ¿Qué va a pasar?”
“Qué ira a pasar hmm… ese tipo de
pensamiento es irrazonable en un principio, así que nada tal vez…”
pasara exactamente?
El equipo de Masato miraba con
Un repentino grito clamo.
“¡M-Maa-kun! ¡Grandes problemas! ¡Ayuda
a mama!”
“¿¡Hah!? ¿¡Espera, oi!? ¿¡Qué paso!?”
Parece ser algo malo, Masato
ansiosamente corrió al cambiador, levantando la cortina, ¡y dentro estaba!
“¡Yahn! ¿¡Qué estás haciendo con esto!?”
Mientras ella estaba intentando poner la
túnica a través de su cabeza, sus manos también terminaron saliendo con su
cabeza, y Mamako estaba luchando al retorcer su cuerpo.
Con sus manos y rostro amarrados por la
túníca, ella estaba en una condición restringida.
Y como ella estaba poniéndose las ropas,
ella estaba obviamente en ropa interior.
Mamako, que parecía como si estuviera
haciendo algún tipo de juego raro, estaba luchando alrededor.
Sus esplendidos pechos estaban
sacudiéndose en todas direcciones, su delgada cadera se retorcía y sacudía.
¡Qué con esa escena! ¡Prohibido bailes
medio desnuda! ¡Erotico!
Sin embargo, esta es su madre.
“Kuh… si solo esta no fuera mi mama… al
menos si fuera alguien más… aunque supongo que experimento una situación de
corazón acelerado como un hombre joven… MALDICIÓN…”
“¡Hey Maa-kun! ¡Quítalo de mama! ¡Mama
quiere que Maa-kun lo saque!”
“¡Eei cállate! ¡Voy a sacarlo fuera, así
que quédate quieta!”
No había un raro sentido detrás, sin
significado raro, solo un hijo desnudando a su madre.
Los buenos chicos y chicas ahí fuera,
por favor solo equípense lo que pueden equipar.
“Haa… las cosas se vuelven demasiado
problemáticas con mama alrededor…”
“Eso es verdad. Cuando la otra parte es
tu madre, se pone un poco difícil actuar a veces.”
“¿Eh? Wise, ¿piensas así también?”
“De seguro. Si hubieras hecho eso a una
chica ordinaria, con un ‘¿¡Qué demonios estás haciendo!?’, podría haberte
mandado a volar ya.”
“No recuerdo preguntarte que tomaras el
rol de castigador.”
“Pero si la otra parte es tu madre, creo
que debería dejarlo solo. Es duro para ti poner tus manos en ella… Aah, perdí
la oportunidad para arrojarte lejos. Aunque deberías volar con un bang en tal
“Muchas gracias por no mandarme a volar
Dejando la tienda donde ellos intentaron
las recomendaciones, ells van a la siguiente con protectores.
Esta tienda también tiene una gran
cantidad de productos, no perdiendo con la anterior del todo. Había un stock
que no podía aburrir a quien le gusten protectores después de un día entero de
buscar. La desconocida tendera dio una mirada [Miren alrededor por ustedes
mismos]. Entonces ellos podrían hacer solo eso.
“Porta-chan puedes decirnos solo sobre
los productos de alta calidad, entonces podemos elegir lo que nos guste y adecuado
desde esos… tener esta cantidad de tipos podría hacer a cualquier inseguro de
que conseguir…”
“Eso es verdad… sería mainstream o ira a
la originalidad… mis sentidos van a ser probados…”
“Ah. ¿No podría esto verse bien en
Wise saco una chaqueta larga de cuero
negro. Era una pieza con símbolos geométricos que recordaba una decoración
mágica a través del cuerpo, y un escudo tatuado y bordado en el hombro derecho.
“Dándole una mirada. Justo como pensé.
Esto es de la rama [Oe & Banale], es bastante fuerte contra aliento de
fuego o hielo ataques. Encima de eso, este tipo puede abrir una barrera
defensiva cuando empujas fuera tu brazo derecho. Es bastante conveniente.”
“Heh. Eso es bastante impresionante…
Eres inesperadamente detallada.”
“Por supuesto. Ya que yo estoy vistiendo
la misma marca justo ahora. ¿Acaso no ves el mismo logo en el cuello?… Mira.”
Wise estiro su propio cuello para
mostrárselo, así que echo una mirada… un,
algo parece oler bien
… no eso.
“Hey Porta, puedes mirarlo. ¿No es esto
“¡Lo estoy apreciando!… Mumumu, esto
es… Equipamiento ligero para Profesión Guerrera… Masato-san puede equiparlo… no
defrauda en mostrar defensa… valor de 30,000 Mamu es adecuado… ¡si! ¡Yo también
recomiendo esto!”
“El sello de aprobación de porta huh.
Entonces ire…”
Ese fue su pensamiento pero, solo un
“Escucha, solo pensaba en algo. Si yo
visto esto… quiero decir… estaría vistiendo una ropa en conjuto con Wise,
“… ¿¡Ha!? ¿¡E-Eso es!?”
La chaqueta larga de cuero negro y la
chaqueta de hechicero que Wise estaba vistiendo eran productos hechos por la
misma marca con diseños similares.
En una mirada, dos personas vistiendo
ropas a duo podría ser… significa que podrían parecen una pareja…
Mientras tanto.
“¡Hey Maa-kun! ¡Echa un vistazo a esto!
¿¡Como se ve esto!?”
Mamako jalo el brazo de Masato
repentinamente. Él camino ahí mientras era jalado.
Para mujer y hombre, dos conjuntos de
armaduras con completamente los mismos diseños fueron mostrados.
Estos fueron hechos de plata blanca.
Cada lugar era refinadamente diligente, encima de que tenía ricos colores de
rojo, que recordaba el magma, y azul, que recordaba al mar profundo. Grandes
poderes que constituían el mundo podrían sentirse pulsando desde aquellos productos
de primera clase.
“Estos se ven como las armaduras para un
héroe hijo y su madre para usar… No puedo evitar sino pensar que están diciendo
“Mama piensa así también. No son del
mismo color como la espada de Maa-kun y las espadas de Mama, ¿las tres espadas
legendarias? Es una coordinación perfecta. Y también, erm… qué es esto… esto es
de alguna forma asombrosa. Hey, ¿Porta-chan?”
“¡Si! ¡Esta armadura tiene completa
inmunidad para estados anormales tales como veneno o confusión!”
“¡Ooh, inmunidad contra estados
“¡Encima de eso, ha sido imbuida con
magia de recuperación para heridas, se activara en un tiempo de intervalo!”
“¡Habilidad de auto-recuperación
incluida!… Oi oi, solo que tan alta especificación puede ser. Definitivamente
quiero esto… Sin embargo, no parece ser fácilmente obtenible.”
El precio mostrado para el conjunto era
29,800,000,000,000,000,000 Mamu.
2,920 kei Mamu[1]. Uno, diez,
cien, mil, diez mil, billón, trillón, kei es, estaba en kei.
“Esto definitivamente no está a la
“Eso es verdad. Como esperaba, no es un
precio alcanzable. Al menos fuera 29,800 Mamu, entonces podríamos de alguna
forma manejarlo.”
“Ese es un precio que probablemente
aparecería en aquellos programas de compras por Televisión. Pero bueno, tal
buen trato no aparecerá…”
Sin embargo, en ese momento, la tendera
de mirada aguda se movio. El precio cambio justo después de escuchar las
palabras de Mamako. Lagos números 0 desaparecieron, el precio se volvió un
increíble 29,800 Mamu.
“Qué demonios… un deseo de padre se
vuelve realidad huh… solo que tantos privilegios consiguen los padres en este
“¡Maa-kun! ¡Dos por 29,800 Mamu! ¡298![2]
¡Es una ganga!”
“Bueno, eso es cierto. Es imposible no
comprar esto… pero… si compramos esto, quiere decir que estaré vistiendo una
armadura a duo con mama…”
“¡Madre e hijo es conjunto es
“No hay manera. Es totalmente imposible…
es imposible no importa como lo mire, pero… umumu… rendirme ante inmunidad
contra estados anormales y auto-recuperación es…”
La armadura radiaba con un brillo que
estaba diciéndole. ¡No hay otra armadura
como yo!
Sin embargo, esto podría hacerlo ser un par con su madre. Masato
estaba de frente con la más grande elección en su vida…
En el mientras tanto, Wise, que estaba
de pie un poco lejos, abrazo la chaqueta larga de cuero negro y vino a ellos.
“¡Alto ahí! ¿¡No me digas que vas a ir a
comprar eso en lugar del equipo que elegí por mí!?”
“¡Piensa cuidadosamente! ¡Mi elección es
también asombrosa! ¡Puede mitigar los ataques aliento del enemigo! ¡Además,
puede abrir una barrera que protege contra ataques mágicos y físicos!”
“A-aah… por supuesto, también tiene un
impresionante alto rendimiento. No hay duda que es un buen objeto… Pero si
elijo eso, podría estar a duo contigo…”
“¡PPPPero! ¡No es completamente igual!
¡Lo diseños son mayormente similares, pero los colores son diferentes!”
“Incluso si los colores son diferentes,
un par es un par. La otra gente lo vera de esa manera.”
Y Mamako naturalmente corto dentro. Al
mismo tiempo, ella se puso en frente de Masato, dando la espalda contra Wise.
“Yo creo que si estas avergonzado sobre
estar a par, entonces está bien si no recomiendas esa chaqueta. ¿No es así,
“E-eso es verdad, pero… ¡ah, eso es cierto!
¡Tengo una razón para recomendarlo!”
“¿Oh, que será eso tal vez?”
“Nuestro equipo no tiene defensor,
¿cierto? ¡Además, si dejamos a Masato equipar esto, entonces podría usar el
escudo cuando es necesario! ¡Hay un valor táctico en esto!”
“No entiendo mucho sobre defensores,
pero si alto poder defensivo es mejor, ¿entonces no es más importante tener un
apropiado equipamiento después de todo? Creo que la armadura que yo elegí es
más dura.”
“Tú eres dura de seguro, ¡pero! Sobre
eso, mira, ¡puedo cubrir eso con magia! ¡Si voy full soporte, entonces es
totalmente bien!”
Con tal, ellas estaban haciendo una
“¡C-cálmense las dos! No hay necesidad
de pelear sobre un asunto de este grado, ¿correcto?”
“Asunto de este grado…?” *Snap.*
“¿¡Yo pensaba que había tal necesario
pensamiento!?” *Snappy snap.* [Chispazo chispeante]
Elegir equipamiento [Elegir ropa] – Eso
era una batalla de mujeres. Un duelo a muerte que probaba sus propios sentidos.
¡Hablar sobre sin sentido significa la muerte! ¡Él iba a morir!
Pero si esto fuera afuera, algo podría
en verdad explotar.
“¡P-Por el momento, ustedes dos
necesitan relajarse!… Ah, eso es… ¡e-es sobre mi equipo! ¡Esto debería ser
algo para que yo decida! ¿¡OK!?”
Masato obviamente hizo la decisión correcta
ya que él iba a usarlo. Cercado, él iba a hacer la elección.
Tener resistencia contra aliento y
función de escudo, coincidiendo con Wise, la chaqueta larga de cuero negro.
Tener inmunidad contra estados anormales
y función de auto-recuperación, coincidiendo con su madre, la armadura
Cual debería él elegir… Masato ya tenía
una respuesta.
Era un asunto simple.
“Ya que tenemos suficientes fondos,
podemos comprar solo ambas. Puedo ajustarme de acuerdo al TPO[3] o
algo como eso.”
Ajustar equipamiento para concordar
contra el patrón de ataque del enemigo eso parecía sentido común en RPG. El
juicio de Masato no estaba mal del todo.
Eso debería ser.
“Tch. Te escapaste. Conseguiste una
“Mama no recuerda enseñarte ser tal niño
Wise y Mamako miraban a Masato con ojos
molestos. Disgustante… Por cierto, Porta tenía una vaga sonrisa. Ella es una
buena chica que sabe cómo confrontar tal situación.
Como eso, un asunto sobre el equipo fue
de alguna forma zanjado… o así parece.
A la mañana siguiente.
“… Mama. Por favor explica esto.”
“¡N-no es lo que crees! ¡Mama no tenía
alguna mala intención! ¡Mama solo pensó que Maa-kun podría estar feliz sobre
“Con ese pensamiento, lavaste durante la
noche y secaste, entonces me lo diste como esto ahora… este objeto ridículo.”
Masato pasó su brazo a través de la
manga de la chaqueta. Sin embargo, su brazo no pudo salir por la manga. Es
extraño, se suponía que era para ser tan largo a la rodilla, se había extendido
al punto de tocar el suelo.
Masato, que estaba vistiendo una larga
chaqueta húmeda, miraba a Mamako con ojos lamentándolo.
“Mama… no puedes usar suavizantes en una
chaqueta de cuero…”
“¡Mama pensó que podría hacer esto más
confortable! ¡Mama pensó que podría darle una buena fragancia! ¡Cuando mama
pensó de esa manera, la ropa solo se expandió y estrecho! ¡Mama en verdad lo
Mamako estaba desesperadamente
inclinándose y disculpándose. Justo como ella dijo por sí misma, ella
probablemente no hizo nada malo… Masato estaba ligeramente irritado.
“Ah, no es bueno… De alguna forma me
siento disgustado…”
Él se sentía disgustado consigo mismo.
Él se sentía disgustado por intentar ir hacia la dirección que él no quería ir.
Él sabía eso, pero no podía parar.
Incapaz de parar.
Él estaba irritado, sin pensarlo,
palabras salían por su propia voluntad.
“Mírame… mama, ¿no te has vuelto un poco
demasiado animada después de venir aquí?”
“¿Eh?… E-eso es verdad… mama esta en
verdad feliz por ser capaz de ir en una aventura junto con Maa-kun…”
“No sobre eso. Estas actuando como loca,
o más bien, no puedes calmarte del todo… justo como esto, hacer cosas sin
pensarlo, jalándome alrededor, ¿pensaste al menos como eso pasa?”
“Mama nunca intento…”
“Incluso si no tenías tal intención, la
realidad termino de esa manera. Aunque yo también quiero pelear en vigorosas
peleas, tú terminas primero antes que fuera más fuerte. Eres siempre la líder
del equipo. No tengo alguna posición del todo. Soy más o menos supuesto a ser
el héroe. Estoy diciendo que espero que puedas considerar tales cosas un poco…”
“Detente, Masato.”
Wise repentinamente interrumpió desde el
“Déjalo en eso. Tú has dicho mucho. Más
importante, te has salido fuera del punto.”
“Ah, bueno, eso es verdad… más bien, esto
debería ser la parte donde Wise se queja con mama. La chaqueta que elegiste fue
“Por supuesto estoy irritada, quiero
hacer una queja, pero… no quiero hacer algo que tú estás haciendo ahora. Podría
sentirme mal sobre esto.”
“Sentirte mal… yo…”
“Se siente mal, ¿cierto? Hey, ¿Porta?”
Wise llamo fuera a Porta y la empujo en
frente de Masatao, “U-Umm…” las pupilas de Porta mostraban ligera ansiedad como
ella le miraba.
Ella se volvió tímida como pensó sobre
Masato y Mamako teniendo una riña… no, eso no era… viendo que Masato estaba
acusando de un solo lado a Mamako, mientras ella no tenía tales intenciones,
Porta miro a Masato como si le condenara.
para con eso. Soy en verdad el malo…
Él sentía como restringía de vuelta su
enojo. Su estómago estaba ya en el punto de ebullición.
Sin embargo, él noto en el último
momento que se podría peor si hacia eso. Él quería ser un hermano mayor genial
ante su linda pequeña hermana. Gracias a tales sentimientos, él lo manejo para
recuperarse. Animándose a sí mismo y poner una buena apariencia.
Masato extingui su enojo junto con un
suspiro, caminado directo hacia Mamako, entonces bajo su cabeza.
“… Lo siento, he dicho demasiado.”
“¿Eh? A-aah, está bien. Mama es la única
que se equivocó. Mama debería ser la que diga perdón. Mama en verdad lo siente
por traer todo tipo de problemas.”
“Aah, si…”
Con ambos lados disculpándose uno al
otro, esto fue resuelto sin algún percance.
Todo regreso a la normalidad… o así
debería ser.
No parece haber funcionado bien. La
atmosfera extraña se mantuvo como estaba, pegándose al cuerpo de Masato al
punto que él se sentía disgustado de esto.
[1] Kei – Una unidad de medida usada en
Japón. Se refiere a 1×106, o 10 cuatrillones o 10,000 trillones.
[2] 298 – Tienda japonesa de gangas que
venden cosas a 2980 yenes. Es como esas tiendas de 1 dólar.

[3] TPO – Tiempo, Lugar, Ocasión.

Okaa-san Capitulo 3 (Parte 3)

Capitulo 3: La ropa interior es protectora. El área defensiva tal vez sea grande. ¡De otro modo el hijo morirá!
“P-P-P-Podría ser, m-m-m-mama,
¿¡e-e-e-es un asunto serio!?” *¡Pánico!*
“Está bien. No necesitas preocuparte.
Penalidad por PK no se activó, creo que probablemente estaba muerta antes del
ataque de mama.”
“Si es solo a la extensión de [Patear el
Cadáver], ¿no está bien? Es ella de todos modos… Más como, ya vez, mi magia
puede revivirla inmediatamente.”
“Gracias. Brevemente informo que he
venido de regreso a la vida sin algún problema.”
Ellos de alguna forma arrastraron su
camino fuera hacia a la superficie.
Masato la miro como si quisiera una
respuesta. La otra parte fue una mujer joven. Ella aparentaba ser una monja,
pero su expresión fue siempre tan calmada y genial que no podía sentir mucha
calidez de eso.
Sin embargo, ya que conocía que tipo de
persona era, él estaba bastante confortable mirándole. Debido a que era solo
ese tipo de persona.

“Erm. Seguro, ha sido desde ayer. ¿Cuál
es tu profesión y nombre esta vez?”
“Soy Shirase. Yo te informo que soy la
Monja Misteriosa Shirase.”
“Lo tengo. Eso es como se siente esta
Ella era Shirase. Una Monja Misteriosa.
“Déjenme felicitar a todos primero.
Muchas gracias por ayudarme esta vez.”
“No, más que decir que ayudamos, parece
como tú ya estabas muerta a pesar.”
“Para mi, revivir=salvar, piensa de eso
como eso… Ahora bien, como mi gratitud, por favor acepta esto.”
Shirase saco un brazalete de entre sus
ropas. No parece ser de alta calidad, era un lindo brazalete con diseño
“Qué es esto… ¿Porta, puedes hacer una
“¡Si! ¡Déjemelo a mí!… Mumumu, esto
es… [Brazalete Agilidad II]”
“Houhou, Brazalete Agilidad II huh… Basado
en cómo no puedo honestamente decir que esto es un brazalete, parece ser un
accesorio trivial.”
“¡Eso no es verdad del todo! ¡Esto es
claramente un objeto mágico! ¡Es un increíble accesorio que incrementa tu
agilidad por dos grados si lo equipas!”
“¿¡Qué!? ¿¡Es eso verdad!?”
Incremento en agilidad… en otras
palabras, velocidad de movimiento durante la batalla podría incrementar.
Sí podría atacar antes que Mamako, su
oportunidad de éxito podría incrementar.
“Muy bien, entiendo, entonces…!”
“¡Es solo perfecto para mí!”
Y el brazalete en la mano de Masato fue
robado por Wise.
“¡Yo recibiré esto! ¡Es absolutamente
mío! ¡Okay, está decidido! ¡Soy la más rápida!”
“¡Oi espera un minuto! ¡No hay punto
para ti incrementar tu agilidad! ¡Te has quedado atrás debido a tu tiempo de
casteo! ¡Esto es para mí, él héroe, para equipar!”
“Hmm, mama piensa que está bien para
Wise-chan para recibirlo. Ya que es gracias a Wise-chan que el monstruo fue
derrotado, Mama lo aprueba.”
“¡No! Qué estas diciendo mama, yo
debería ser…!”
“¡Yo creo que si Mama-san decidió eso,
debería estar bien!”
“Estoy de acuerdo con Mamako-san, por
Tres contra uno, esta propuesta fue
“Kuh… Resiento la influencia de mama…”
“Nfufu Sin añadir más, vamos a equipar
esto Aquí.”
Wise intento poner el Brazalete Agilidad
Sin embargo, la carne excedente en su
brazo superior resistio, ella no podía propiamente usarlo.
“¿O-Oh?… ¿Q-qué ocurre con esto?… No
hay manera… no puede ser…”
“¡Pu! ¡Solo tienes que ser más delgada
en ese lugar!… Sin embargo, si es así para ti, entonces en mi caso,
probablemente no pasara incluso en la parte baja de mi brazo.” *Deprimido*
“¡Basado en mi estimación visual, creo
que el brazo de Mama-san es del tamaño perfecto!”
“Oh, ¿es eso así? Entonces supongo que
lo intentare.”
Mamako tomo el brazalete desde Wise que
se perdió en asombro, y lo puso en la parte superior de su brazo.
Que tamaño perfecto. El brazalete se
anclo en el brazo de Mamako como si fuera succionado dentro.
¡La agilidad de Mamako incremento por
dos grados! ¡Ella se volvió una madre que podría limpiar los enemigos con sus
ataques rápidos más que cualquiera de sus acompañantes!… En el otro lado, la
oportunidad de los otros acompañantes para mostrarse fue mucho más reducida.
“¡Oh bueno! ¿¡Qué debería hacer mama!?
¡Mama parece haberse vuelto mucho más activa!”
“Sería problemático si no lo fuera… Fuu…
tuve razón en ajustar a su tamaño para ser solo Mamako-san capaz de equiparlo…
ahem ahem… debería parar de informar cosas innecesarias. Eso es lo que Shirase
“Sabía que esto podría ser el caso… TAN
“Las madres consiguen demasiadas
modificaciones… hay algo mal con tu cabeza…”
“El niño respetara a un padre capaz,
entonces profundizar sus lazos. Que hermosa relación padre-niño… A pesar, eso
dicho, solo darle ventaja a los padres es…”
““Ah geez, de alguna forma, he perdido
mi motivación.””
“Niños se quejaran como tal, así que
para ustedes dos, permítanme presentarles estos asombrosos objetos que les
dejaran descubrir el poder de los fuertes lazos.”
Mientras decía eso, lo que Shirase saco
fueron un simple par de anillos sin muchas decoraciones que podrían atraer la
mirada de la gente. [K: anillos de boda… kamo]
“Porta. Aprecia esto primero.”
“¡Si!… Mumumu, esto es… ¡[Anillos
“¿Qué es eso?”
“¡Es un accesorio combo! ¡Cuando dos
personas se equipan esto, después que una persona ataque, la otra será capaz de
seguir el ataque inmediatamente!”
“¿¡Eso significa, Cancelación de
Casteo!? ¿¡No es eso lo mejor!? ¡Es perfecto para mi!”
“Fufufu. Es genial para usted estar
feliz… Fuu, con esto, el contenido de insatisfacción del lado del niño ha sido
completado. Pedazo de pastel.”
“Podría haber sido genial si no dijeras
aquellas palabras, ¿Por qué tienes que decirlas?”
“Yo informo de cosas que no deberían ser
informadas. Esa es la calidad de Shirase… Así bien, debería dar mi salida
Shirase dio su despedida y estaba solo a
punto de irse, “Aah, es cierto.” Ella repentinamente se detuvo, dio la cara al
equipo de Masato, y hablo solemnemente.
“Lo siento por el asunto urgente, pero
después de evaluar la fuerza de todos, tengo una quest que deseo darles a
“¿Quest?… Eso es bastante repentino…”
“Si. Una quest de emergencia, o una
quest especial, piensen de esto como una de esos tipos. He preparado la
recompensa de esa parte también, así que por favor.”
“¡Bueno! ¡Estoy mirando por delante por
la recompensa!”
“¿¡Qué tipo de cosa conseguiremos!? ¡Yo
también miro por delante a eso!”
“Solo va a ser para uso único de
Mamako-san, ¿cierto? No me creas una tonta.”
“No no, esa recompensa es algo que todo
el mundo puede usar, así aseguro… Si están interesados, por favor vengan a la
villa llamada Aldea Maman al oeste del Pueblo Kassan. Hablare sobre los
detalles ahí.”
“… Es lo que dices, ¿pero?”
“Algo que solo puedes decirnos después
de ir al lugar, eso es sospechoso. ¿No estas intentando en involucrarnos al
respecto?… Personalmente, tengo un mal presentimiento sobre eso…”
Wise murmura tal cosa, mientras Shirase
parece mostrar en ella una rara sonrisa.
“Si van a aceptarlo, deberían primero
preparar su equipamiento en el Pueblo Kassan, y entonces intentar el reto.
Recomiendo que vengan completamente preparados. Ahora bien.”
Shirase mostro una ligera sonrisa y
camino fuera como eso.
“Una quest directa de Shirase-san huh…
Siento que no será fácil a pesar.”
“Yo también estoy de acuerdo. Pero no
miento que estoy curiosa sobre la recompensa. En verdad curiosa.”
“¡Yo también estoy curiosa! ¡Me pregunto
si recibiremos algún objeto increíble!”
“Verdad… Es cierto que estoy curiosa en
varias maneras…”
Mamako tomo las manos de Porta,
reuniendo toda la atención, y anunciando con un rostro sonriente desbordando
con alegría, asombro y juventud.
“¡Primero son las compras! ¡Vámonos! ¡Ou!”
A pesar de lo que viniera, primero
debería ser comprar.
Ellos regresaron al Pueblo Kassan de
nuevo. Trayendo una larga cantidad de gemas obtenidas de las batallas en el
centro de intercambio, ellos intercambiaron por una pesada bolsa de monedas de oro.
Los fondos se volvieron abundantes. Entonces, sería el asunto de que deberían
comprar con eso.
“¡La habilidad básica del mercante
viajero es dar un 10% de descuento! ¡También, tengo la habilidad apreciación,
así que por favor déjenme elegir los víveres a mi! ¡No malgastare un solo
“¿Mamu? ¿Qué es eso?”
“¡Es la unidad de dinero!”
“Es eso así… basado en los varios
víveres que he visto, 1 Mamu parece valer cerca de 1 Yen…”
Como estaban hablando sobre tales cosas,
Mamako los guio al mercado al aire libre mientras miraba alrededor.
Lo que hizo a la líder Mamako detenerse
“¡Mira mira, Maa-kun! ¡Estos huevos son
baratos! ¡Una tapa de doce solo cuesta 100 Mamu!”
“Oi mama. Mirar por nuestra comida de
cada día es…”
“¡Hey esa joven señorita de ahí! ¡Por
favor pruebe algo de esto ¡Bistec de Minotauro Diced, es deliciosa!”
“¡Oh mi, es en verdad deliciosa! ¡Vamos
a conseguir un paquete!”
“No, ¿ya vez? Comprar comida es…”
“¡Ah, la hermosa onee-san de ahí! ¿¡Que
hay sobre este asombroso Serum que puede hacer tu piel brilla más brillante!?
¡Ahora puedes conseguir un set especial de tres tubos por solo 3000 Mamu!”
“¡Bueno! ¡Tal vez sea adecuado para mi
piel! ¡Supongo que lo tomare!”
“¡Mira de cercas al precio! ¡Un tubo
también cuesta 1000 Mamu, así que no es barato para nada!… ¡Más importante,
calmate un poco! ¡Mama, préstame atención!”
Él atrapo el rostro de Mamako y miro
directo a ella. Una importante educación.
“Ya vez, mama… estamos actualmente en un
juego y preparándonos para nuestra aventura.”
“E-eso es correcto. Mama también
propiamente entiende eso.”
“¡No, no lo haces! ¡Mama no entiende ni
un poco!… ¡Comprar en RPG significa armas, equipos protectores, y objetos,
estos son los tres básicos! ¡No hay necesidad de comprar otras cosas!”
“C-Como puede eso ser… entonces,
“¿Nn? ¿Qué es?”
“¿¡Mama no puede comprar los calcetines
y calzoncillos de Maa-kun!? ¿¡Maa-kun está aún usando calcetines y calzoncillos
desde ayer, eso quiere decir que mama no puede lavarlos y tiene que continuar
usándolos por hoy, mañana y así!?”
La voz impactada de Mamako hizo eco
fuertemente. Incluso llego a aquellos pequeños callejones en el mercado al aire
Masato… que era bañado con las miradas
de los alrededores que sabían que él era el joven que vestía el mismo conjunto
de calcetines y calzoncillos desde ayer fue…
“… Necesidades diarias están
Él no tuvo elección, pero dijo eso en
Con eso dicho, ellos arribaron al área
donde las necesidades diarias y tiendas de ropa estaban alineadas en una recta.
Había tiendas que mostraban ostentosas ropas en sus anaqueles y tiendas que
usan el método de vagones de ventas por apilar ropa interior barata en el
cargamento, así que no importa a donde mirara, ellos podrían solo ver ropas.
“Lo siento. Mama debería comprar la ropa
interior de Maa-kun primero. Calzoncillos, calcetas, camisetas. También,
algunos pañuelos y toallas. ¿Necesitamos comprar pijamas?”
“… Solo elije los que quieras…”
“Eso no lo hare. Maa-kun tiene que
tomarlos. Porque la última vez que mama trajo calzoncillos para Maa-kun por si
misma, estabas muy enojado, gritando, ‘¡No puedo usar esto!’”
“Eso es debido a la pobre elección de
mama… Algo como yo usando unos calzoncillos de estampado de kuma (ositos), eso
es imposible…”
“¡Umm, Masato-san!”
“¿Hmm? ¿Qué pasa Porta?”
“¡Yo creo que la ropa interior con
estampado de kuma es linda! ¡Yo estoy vistiendo una justo ahora!”
Masato miro hacia abajo en frente de
Porta, mirando a su gentileza y refuto “No puedes decir ese tipo de cosas
directamente en frente de otros chicos más que yo, ¿entendido?” “¡Si! ¡Lo
Diciendo eso en frente de Masato estaba
a salvo. Porque él era un caballero.
“¡Umm, quiero decir una cosa más!”
“¿Qué es Porta? ¿Qué tipo de cosas
asombrosas escuchare esta vez?”
“¡He aprendido algunas habilidades de
Creación de Objetos! ¡Si tengo algo de material de tela, puedo hacer los
calcetines y calzoncillos de Masato-san! ¡Es por eso!”
“¡Muy bien lo entiendo! ¡Vestiré tus panties!”
“Policía, es esta persona.”
“¡Correción! ¡Voy a vestir los
calzoncillos que hagas!”
Fuu, eso estuvo cercas. Mi vida podría
acabar por un ligero desliz de mi lengua.
Y entonces, todo el mundo estaba
charlando mientras miraban alrededor.
“¡Ah, los aventureros de ahí! ¡Por favor
intenten este equipo protector! ¡Tengo algunas buenas mercancías alineadas!”
El que llamo fue una tendera femenina de
tienda tratando con equipo protector al lado del área de ropa.
Extendido en frente de la tienda había productos
de cuero, armaduras metálicas y escudos que eran pesados, pero se jactaban de
alto poder defensivo. Había varios diseños, desde el tradicional estilo Europeo
al estilo étnico individual. Ellos podrían tomar cualquiera que gusten.
“¡Ooh, finalmente llegamos a el destino!
¡Esto es! ¡Estas son las cosas que quiero comprar!”
“¡Eso es correcto, eso es correcto!
¡Esta tienda tiene productos que queridos clientes están mirando! ¿¡Por cierto,
que hay sobre esto!?”
Lo que la tendera les mostro fue… el
clásico “eso”.
Es más o menos adjuntando a la categoría
de armadura, pero el área de protección en el cuerpo fue extremadamente
pequeño. Solo ocultando desde el pecho al abdomen, y ajuntando hombreras como
extra, “eso” era para uso femenino.
“Hohou. Esto es lo que llaman, una
Armadura Bikini.”
“Es una armadura que persigue movilidad,
¿no se siente bien?… Ven, querido cliente. Por favor recomienda esto a tus
compañeras. Es un equipo protector, así que no hay nada para avergonzarse sobre
“¡N-no digas tales cosas estúpidas!
¡Este tipo de cosas no puede ser recomendado por un chico! Sin mencionar, mi
equipo tiene alguien que absolutamente nunca debe vestirlo…! ”
“Oh, que asombroso. Esta es la primera
vez que mama ve algo como esto.”
“¿¡La última persona que debe vestir
esto tomo la carnada!?”
Mamako tomo la Armadura Bikini desde la
tendera y lo miro con profundo interés.
“¿Está bien si intento ponérmelo?”
“¡Por supuesto! ¡El cambiador está por
ahí, así que por favor consienta a su corazón! ¡Hay varios otro tipos en
aparador disponibles, así que por favor tomen el que gusten!”
“Ah, ¿es eso así? Entonces… creo que
intentare usar esto, y esto.”
“Ya que Mamako está intentándolo,
debería también intentar algo.”
“¡Entonces, entonces tal vez intente también
“¡Por supuesto! ¡Tres queridas clientes
femeninas, por este lugar por favor!”
Mientras tanto, el grupo femenino
tomaron el equipamiento que querían intentar, y fueron a los simples
cambiadores que la tienda había preparado.
Masato solo fue dejado atrás.
“Así que, puedo solo esperar ahora,
“Los hombres tienen que pasar a través
de tal momento. Resígnese a sí mismo.”
[K: Te comprendo mí querido amigo… pero
al menos no soy un princeso como tú… fufufu…]

Masato fue palpado en el hombro por la tendera y suspiro inconscientemente.

Okaa-san Capitulo 3 (Parte 2)

Capitulo 3: La ropa interior es protectora. El área defensiva tal vez sea grande. ¡De otro modo el hijo morirá!
“Te dije, mama… Te imploro, por favor llámame
normalmente primero. Ya que estaba bastante cercas.”
“Atacar compañeros no parece accionar
penalidad… derrotar a Mamako-san… esa se volverá mi meta de vida…”
“¡Lo siento! ¡Lo siento por ser una mama
que usa técnicas que justo ha aprendido!”
Mamako estaba bajando su cabeza en
disculpa. No vamos a mencionar donde, pero ellos fueron sacudidos un montón.
Saltando de arriba y abajo, no fue el tipo de situación para mirar lo que paso.
“Así que, había algo que querías que
nosotros dos fuéramos a mirar, ¿es eso correcto?”
Mamako trajo a Masato y Wise consigo y
descendieron la colina. Parcialmente debido a la influencia del [Colmillo de
Madre], una porción del terreno había deformado ligeramente, una enorme caverna
abierta en la forma de un cuenco desde la gran movilización de los pastizales.

Una soga había sido fijada y bajaba
hacia la caverna y el rostro de Porta se mostró desde el interior. Qué con esta linda como de una cueva de
conejo. Así de linda. Muy bien, vamos a continuar.
“¡Ah, Masato-san, Wise-san, bienvenidos
de vuelta! ¿Están a salvo?”
“Bueno, de alguna forma. ¿Qué haces
“Solo echaba una mirada rápida dentro.
De hecho, hay señales de tesoro dentro de esta caverna.”
“Los mercantes viajeros tienen sentidos
agudos para ese tipo de cosas huh… Así que, ¿Cómo es? ¿Acaso parece ser algún
tipo de ostentoso tesoro? ¿Acaso se siente como un tesoro oculto?”
“Es lamentable, pero siento como no es
mucho dinero. Sin embargo, siento que hay una extraña herramienta dentro.”
“Alguna extraña herramienta huh… fumu…”
“Hey Maa-kun, ¿qué crees que deberíamos
deberíamos hacer?
Masato se preguntó por un poco.
Caza de tesoros. Él honestamente quería
hacerlo si solo pensaba en aquellas palabras.
Sin embargo, después de mirar las
apariencias con una mente calmada… dejando de lado a Porta y Wise, los
equipamientos de Masato y Mamako eran material preocupante.
Masato vestía una chaqueta y pantalones
para casa. Mamako vestía un vestido de una pieza para salir.
Dejando de lado el poder de ataque, su
poder defensivo era puro-hueso.
peligroso si peleamos contra monstruos en este estado en este punto de momento,
y cazar tesoros encima de eso…
Él debería tragarse las lágrimas y
rendirse aquí. Él creía que debería ser una elección segura.
Sin embargo, ¿estaba en verdad bien
dejar esta caverna que tiene un objeto especial sola? Mientras el equipo de
Masato estaba aún preparando sus equipamientos, hay una alta posibilidad que
otros aventureros tal vez encuentren por coincidencia y busquen alrededor. En
ese caso.
“… Wise. ¿Puede tu magia elevar el poder
defensivo de mama y mío?”
“Por supuesto. Magia defensiva es la más
básica de las bases. Es un asunto de aprenderlo de hecho. Tu valor de poder
defensivo incrementara hasta que el buff termine. Mira delante por mi magia.”
“Muy bien, lo he decidido… Así que
“¡Así que entonces, vamos a cazar
tesoros! ¡Vamos a dar lo mejor!”
“Hey, se supone que sea mi comando…”
Bajo el liderazgo de Mamako, “““¡Ou!”””
ellas respondieron, el equipo de Masato comenzó su infiltración en la caverna. “¡Déjenme
guiarlos hacia abajo hasta donde he ido!” Porta descendió abajo en la caverna
“Yo iré abajo después. Yo debería ser el
líder del equipo de exploración. Solo obtuve el título de capitán explorador.”
“Entonces mama ira después… oh no,
pensando sobre eso, mama está vistiendo una falda. Maa-kun me vera desde
debajo. *Sonrojo*”
“¡Deja de sonrojarte, madre! ¡No mirare
incluso si muero!”
“Diciendo eso que no miraras incluso si
mueres… sob sob… aunque mama esta vistiendo un nuevo par… aunque es una de T de
atrás así la línea de la ropa interior no se mostrara en su trasero…”
“¡Para de dar información innecesaria!
¡Bien, vas a bajar primero! ¡Yo iré después!”
“¡Espera ahí! ¡Yo también estoy
vistiendo una falda! ¿¡Estas intentando fisgonear desde abajo!?”
“¿¡Eeh!? ¡Aunque no quieres ver la ropa
interior de mama, quieres ver la de Wise! ¿¡Que significa eso!?”
“¡Es totalmente normal! … ¡Ah, no, no es
como quiera ver la de Wise! ¡Aah, lo que sea, Wise baja primero! ¡Iré solo al
Mamako desciende hacia la caverna
conectada por la soga, y Wise continuo luego. Finalmente, Masato comenzó a
descender dentro de la caverna… en ese momento.
Una voz hizo eco desde debajo.
“… te!… endo…to!…”
Porta parece estar gritando algo, pero
no puede ser escuchado bien.
“¡Oi Wise! Porta parece estar diciendo
algo desde abajo, ¿¡acaso la escuchas!?”
“¡Espera un momento! ¡Intentare
escucharlo con Mamako-san!… ¡Mamako-san!”
“… tente!… tro… tos!… peren…
“¡Ah, si! ¡Lo tengo! ¡Confiare eso!”
“¿Qué es lo que dijo?”
“¡Ella está diciendo que la soga no
puede soportar a cuatro personas descendiendo juntos, así que por favor esperen
por un momento!”
“¡Ya veo ya veo! ¡Lo tengo! ¡Entonces me
ayudas a pasar el mensaje para abajo!”
“¡Deseo que ella dijo eso antes, eso
“¡Bueno, eso es verdad! A este ritmo,
tarde o temprano, más bien nos encontraremos con ellas en una velocidad inusual
así ¿¡NUaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaah!?”
Incapaz de sostener su peso, la soga se
rompió. El equipo de Masato comenzó a caer libremente.
“¿¡Esta todo el mundo bien!? ¿¡Alguien
está herido!? ¡Por favor respondan!”
“¡S-si! ¡Estoy bien!”
“Estoy también bien. No problem del
“¿¡Que hay sobre Maa-kun!? ¿¡Mama puede
escuchar la voz de Maa-kun!? ¿¡Maa-kun, estas bien!? ¿¡En donde estas!?”
“Ah, Masato está bien. Él está bajo
nuestros pies.”
“Acaso eso tiene sentido… Fue el último
en bajar por la soga, así que porque soy el primero en caer contra el suelo y
ser pisoteado… no tiene ningún sentido…”
“La razón es simple. Use magia para
flotar en todo el mundo del equipo excepto en ti. Es una magia de todos los
objetivos con excepción de un objetivo específico, no mencionar que nosotros
tres aterrizamos encima de esa excepción, que avanzada técnica, ¿no es así?”
“Conseguiste algunas técnicas inútiles…”
“Por cierto, tú ya has sido buffeado con
magia defensiva. ¿No estas herido cierto? ¿Cómo es? ¿Has entendido la grandeza
de mi magia? Si lo entiendes entonces elógiame. Vamos.”
“Si si, genial genial… Así que, eso está
bien y todo, pero…”
Masato resistió el peso de las tres
personas en su espalda, y elevo su rostro para mirar alrededor.
Sin embargo, él no pudo ver una cosa.
Los alrededores eran completamente oscuros. Fue tan oscuro que no podía ver
incluso sus propias manos.
“Oi Wise. Enciende este lugar por el
momento. No puedo incluso pensar sobre qué hacer con esto.”
“OK. Deja a esta asombrosa Sabia que soy
yo. ¡Hare un Chainspell de magia de fuego para iluminar este lugar en un
pestañeo!… Supra・La・Magia…”
“¡Oi para eso! ¡No sabemos lo que nos
rodea así que no liberes repentinamente fuego! ¡Si lo haces pobremente, también
seremos quemados! ¡Usa simple magia de luz para hacer eso!”
“Eh… e-erm… ese tipo de magia, um… como
debo ponerlo…”
Wise estaba en problemas. Lo tenía
escrito, además, con sus tacones retorciéndose y sus pies patenado. Por
supuesto, ella estaba retorciendo y pateando la espalda de Masato. El tomo 0
daño debido a la magia defensiva, pero fue muy molesto.
“¿Qué con eso? ¿No puedes usar ese tipo
de magia? Geez, que molesta molestia. Aunque ahora era la oportunidad de
mostrarte y conseguir respeto.”
“¡No digas ese tipo de cosas! ¡Se que es
lo mejor de mi!… Kuh, pensar que es inútil y no aprenderla es mi culpa…”
“No tiene caso… Entonces es el turno de
un objeto aquí. Porta, ¿tienes algo que pueda iluminar?”
“L-Lo siento… de hecho, creo que tire mi
bolsa durante la caída de justo ahora… No tengo nada justo en ese momento…”
“Oi en serio… estamos en problemas…”
“¡Lo siento! ¡En verdad lo siento! ¡En
verdad lo siento por ser inútil!… Sobre la soga también, podría haber estado
bien si hubiera dicho eso primero… sniff…”
La voz de Porta quebró en lágrimas.
*Sniff sniff* ¿Qué podría ser sino llorara?
“O-Oi. No es culpa de Porta, ¿lo
entiendes? No necesitas llorar, ¿sabes? ¿OK?”
“Sniff… pero lo siento… sob… Lo siento
por ser inútil…”
“No, esta bien. Porta es una chica muy
útil. No es malo del todo. Yo lo reconozco.”
“Hey espera, esa manera es demasiado
diferente a como me hablas. ¿Qué es esto?”
“Una evidente diferencia en el rango de
“¡Porque tú!”
Su pisoteada en su espalda incremento en
intensidad, pero lo dejo solo ya que no había daño.
“Sniff… lo siento… en verdad lo siento…
“Umm, emm… o-oi, ¿Porta? No tienes que
preocuparte del todo, ¿ok? Te lo imploro, por favor para de llorar, ¿ok?”
¿Qué hare? ¿Qué debería hacer? Lo siento
por mi pobre manera de hablar, no puedo decir nada así que por favor perdóname,
aunque estoy disculpándome mientras estoy siendo pisado ya…
Paso justo entonces. Una voz llena con
gentileza, calidez y suavidad hablo.
“Porta-chan. Está bien. Todo el mundo
hace equivocaciones. No tienes que preocuparte sobre eso.”
“Mama-san… sob… p-pero… caimos dentro de
esta cueva completamente oscura, que deberíamos…”
“Está bien. Lo manejare de alguna forma
sobre un problema de este grado. Vamos a animarnos juntos. ¡Ei, ei, ou!”
Mamako elevo su voz animada. Cuando eso
Radiante luz ilumino los alrededores.
Mamako estaba brillando.
Mamako aprendio la habilidad especial
[Luz de Madre].
“Hey, ¿¡que esta pasando!? ¿¡Mama está
brillando!? ¿¡Luz está viniendo de su cuerpo entero!?”
“¡Mama-san es increíble! ¡Es muy
brillante! ¡La luz brilla radiantemente!”
“Eso me recuerda, mi mama también brillo
un poco en el día… ella estaba tan trillada a viajar con su hija que ella
siempre actuaba tan radiante… fuu, esa es alguna historia nostálgica…”
“Qué con las madres en este mundo… acaso
consiguieron alguna modificación de habilidad rara…?”
Respecto a eso, gracias a la luz
brillante del cuerpo entero de Mamako, los alrededores fueron iluminados.
Parece que el equipo de Masato estaba en
una división de tres caminos en la cueva. Mirando arriba era la cueva vertical
que no podría ser vista ahora que continuaron, y una cueva en a su izquierda y
derecha. Estas cuevas eran lo suficientemente grandes como para ellos caminar
sin estrujar sus cuerpos al caminar profundamente.
“Después de venir tan lejos, vamos a
pensar como salir de aquí luego. Pensaremos en eso después de conseguir el
tesoro. Esa es probablemente la manera en que un aventurero lo haría.”
El equipo del héroe podía solo moverse
hacia adelante.
“Vamos, Porta. Ahora es tu turno.
¿Puedes guiarnos a donde el tesoro esta?”
“¡S-Si! ¡La señal viene de aquí!
¡Déjenme guiarlos ahí!”
Porta levanto con su hombro la bolsa que
cayo cercas, y repentinamente comenzó a correr en la caverna a mano derecha
llena de motivación. “Mi, mi, es peligroso correr.” Mamako le siguió por detrás
mientras iluminaba los alrededores con su cuerpo entero brillando…
““… Ah…!?””
Y entocnes las dos regresaron tan pronto
se fueron. Porta y Mamako mostraron una increible intensaidad en sus rostros
como ellas corrieron de regreso mientras gritaban. “¿¡Wahyaaaaaai!?”
“¿¡Whwhwhwhwhwhwwhwha!?” Ellas parecían estar en pánico.
“Hey, que les paso a ustedes dos… huh…
¿¡algo esta viniendo!?”
Ligera vibración fue transmitida bajo
sus pies. Parece que era algo grande lo que estaba corriendo hacia ahí. Masato
rápidamente tomo una postura.
Su premonición dio en el blanco. Detrás
de la desesperada Porta y Mamako… con un enorme y suave cuerpo que era redondo,
estaba ‘eso’. Un slime.
“Oi oi, un clásico entre los clásicos
salió fuera huh… incluso así, es en verdad grande.”
“Es grande de hecho, pero no es esa la
cima de los monstruos basura, ¿un slime? Ese tipo de cosa, usare mi magia de
muerte instantánea… Deja a esta flama explosiva producida por mi
En ese momento, el enorme slime impacto
su cuerpo y dejo salir un sonido anormal. Ese sonido permanencia en la caverna
Mamako no fue afectada. Porta no fue
afectada. Masato no fue afectado.
La magia de Wise fue sellada. “Qué
diablos…” Wise de pie mientras miraba hacia el suelo bajo sus pies con ojos que
parecían decir que ella fue traicionada por todo en este mundo. Ella no tenia
nada más que hacer…
“¡Entiendo tus sentimientos, pero piensa
sobre la situación! ¡Tú idiota!”
“¿Eh?… Ah…!?”
Ese enorme slime corrió hacia delante.
Masato rápidamente jalo a Wise hacia él y la empujo contra la pared de la
caverna. (TLN: Esplendido Kabe-don. ¡Masato anota!) Ahí, él la cubrió a ella
como un escudo. “¿¡Espera!? ¿¡Estas presionándome!?” “Está bien, no te muevas…
¿¡uoooh!?” Con elasticidad rebotante aplastando la espalda de Masato y empujado
justo como eso.
“¡Kuh! ¡El frente de mi cuerpo siente
como estas golpeando algo, pero mi espalda se sienta tan placentera que no
puedo sentir nada del frente!”
“¡Lo siento por tener un tamaño que no
se puede sentir!”
“Uh bueno, ahora no es el momento para
decir tales cosas. ¡Vamos a perseguir esa cosa!”
“¡Ah, hey, espera! ¡Al menos déjame
golpearte una vez!”
Mamako y Porta podría probablemente ser
alcanzadas. Estaban siendo perseguidas y continuaban corriendo. Masato
ágilmente esquivo la cachetada(golpe) del grimorio de Wise, y las persiguió
después al enorme slime con la asombrosa elasticidad.
Gritos y temblores continuaron
profundamente dentro de la caverna horizontal. Wise, que tenia un pecho
modesto, estaba enojadamente arrojando grandes rocas que encontraba a su paso
hacia Masato. Profundamente dentro.
Después de correr por un momento, luz
pudo ser vista delante de la cueva. Después de elevar su velocidad y llegar al
punto, él vio un amplio espacio en frente de él. Una enorme, y vacía área
estaba excavada en la tierra. Mamako y Porta estaban cerca de la entrada.
“¡Mama! ¡Porta! ¿¡Están las dos bien!?”
“¡Si! ¡Mama-san y yo estamos bien! ¡No
estamos heridas!”
“Mama fue un poco sorprendida, pero de
alguna forma bien. Más importante… eso…”
“Aah… eso es alguna cosa ostentosa ahí…”
El interior de la cueva era brillante.
Al principio pensó que era debido a la luz emitida por Mamako de seguro, pero
eso no fue el caso. Fue el enorme slime quien estaba brillando.
Luces ilusorias como luciérnagas volaban
dentro, y el enorme cuerpo de ese slime las absorbió una después de otra. El ya
enorme slime continúo expandiéndose más.
“Si no hacemos algo sobre eso pronto,
las cosas se saldrán de las manos… ¡muy bien, vamos a hacerlo!”
“¡Entendido! ¡Mama también trabajara
duro!… ¡Porta-san, ve rápido a un lugar seguro, rápido!”
“¡Si! ¡Les daré todo mi apoyo!”
“¡Muy bien! Entonces mama y yo juntos…!”
“¡Esperen un segundo! ¡Yo también estoy
Y la que elevo su voz fue Wise.
“Oi, no digas tonterías. Tú magia fue
sellada, ¿cierto?”
“Lo siento por contradecirte. El tiempo
ya paso, el sello en mi magia ha sido levantado. Puedo usar magia de nuevo…
Ahora es el momento para mi habilidad…!”
En ese momento, el enorme slime sacudió
su cuerpo un poco. Ese sonido anormal hizo eco dentro de la caverna de nuevo.
Mamako no fue afectada. Porta no fue
afectada. Masato no fue afectado.
La magia de Wise fue sellada. ”¡Sabía
que podría pasar esto!” Wise a regañadientes uso su grimorio como una almohada
y se tiro al suelo. Con su magia sellada, ella no podía usar magia, así que se
volvió una decoración.
“Que patética. Ve a un lugar seguro a dormir.
Porta, ¿puedes encargarte de ella? … Mama, ¿está viniendo?”
“Está bien. ¡Mama trabajara duro y lo
“Lo siento por arruinarte el momento,
pero seré el único que lo derrote. Así que… ¡vamos!”
Masato empuño su Espada Sagrada del
Cielo Firmament, Mamako sostuvo su Espada Sagrada de la Madre Tierra Terra di
Madre y la Espada Sagrada de la Madre Agua Altra, el héroe y su madre se
movieron fuera al mismo tiempo.
Masato hizo un tajo preventivo. “¡Mi era
ha finalmente llegado!” Empujando todo el camino de la punta del slime
expandiéndose, él tajo con todo su espíritu…!
Miss. El enorme slime salto con
velocidad que no coincidía con su enorme masa y evadió el ataque de Masato
“¿¡Kuh!? ¿¡El movimiento de este maldito
es rápido a pesar de su gran tamaño!?”
“¡Déjaselo a mama! ¡Eii!”
Mamako cruzo Terra di Madre y Altra,
entonces balanceo ambas en una ida. Esto fue dentro de una caverna subterránea.
Hojas de piedra sobresalieron desde la pared de tierra en todas direcciones,
además agua borbotando en barricadas fue disparada junta a esto. Esto podría
ser imposible de evadir…
Miss. El enorme slime salto alrededor en
alta velocidad como una pelota de goma, esquivando todos los ataques.
Había solo un enemigo. Podría ser un
fácil overkill si propiamente tomaba daño, pero si no podían golpear, entonces
era obvio que no había daño.
“N-no hay manera…aunque mama trabajo
duro… mama se siente desanimada.” *Deprimida*
“¡Oi mama! ¡No te desanimes! Apúrate y
Esta aquí.
El slime abrió un agujero por
transformar y escupir grandes cantidades de fluido. Su masa fue como loción y
se acercó a ellos dos a la vez. El objetivo de su ataque fue… Mamako.
“¡Kuh! ¡Mama!”
Masato velozmente empujo a Mamako hacia
el suelo.[TLN: Kabe-don upgrade: ¡Yuka-don! ¡Masato anota crítico!] Él
inmediatamente uso su cuerpo como un escudo para protegerla, pero… su oponente
era fluido. El abrumado par fue tragado por el flujo viscoso.
Entonces, viendo que el flujo había
cesado, cuando Masato estaba por levantarse…
“¡Buha! ¡Mama! Estas bien… huh… ¿eh?”
El vestido de una pieza que Mamako
vestía, que fue empujado bajo Masato, comenzó a derretirse.
Incluso el bra que ella vestía debajo
Las colinas gemelas bien formadas de
Mamako *boing* se revelaron ante sus ojos.
largo tiempo de no verlas. No había dado una buena mirada ya que en ese tiempo
de nuestros baños juntos fue cuando era pequeño.
“¿¡Hey, espera!? ¿¡Que está mal!? Aunque
mis ropas no muestras signos de derretirse… ¿¡ah!?”
Como estaba en pánico, su mano se
deslizo en el fluido y “¿¡Mufu!?” el rostro de Masato fue empujado entre
aquellas colinas. *Squish squish boing boing* Incluso si intento levantarse, su
mano se deslizaba, y el ciclo se repetía sin fin.
“¿¡Hey espera!? ¿¡Mufu!?
¿¡*Deslizándose*!? ¿¡Mufu!?”
“¡NNNNo, Maa-kun! ¡Mama y Maa-kun son
madre e hijo! ¡No importa lo mucho que quieras a mama, pienso que empujar a
mama al suelo, derretir las ropas de mama e intentar hacer algo! ¡Al menos, al
menos apaga las luces!” *¡Brilla!* [K: Así que a la mama no le molesta… fumu,
“¡Tú eres la única encendida! ¡Más bien,
no digas tales cosas raras! ¡Este no es el lugar para tontear!”
“¡P-Pero! ¡Mama esta empapada! ¡Hey,
Maa-kun! ¡Mama fue empapada! ¡Tú sabes, empapada!”
“¡Calmateee! ¡No digas nada más que
esooo!… ¡S-Solo déjame apurarme y levántate! ¡Tú ve y cambia tus ropas!
Tienes un cambio de ropas, ¿¡cierto!?”
“¡Ah, eso es cierto! ¡Mama trajo un
cambio de ropas! ¡Entonces mama va a irse por un momento!”
Mamako sostuvo la parte de la falda de
su vestido de una pieza que fue derretido y se retiro rápidamente.
Sin embargo, viendo la figura de Mamako
corriendo hacia el lugar de Porta y Wise para pedir su equipaje, Masato
repentinamente tuvo un molesto sentimiento.
“… ¿¡Ah, no es bueno!? ¿¡Si mama va
hacia allá!?”
SLIME – Fue una existencia que derrite
ropas femeninas. Fue algo que ignoraba las varias razones.
¿¡Si Porta y Wise son también capturadas
por el solvente slime, podría volverse en un festival desnudo de tres
¡Y entonces vino el destinado enorme
slime persiguiendo!
El fluido viscoso que fue disparado de
nuevo trago a aquella chica joven y pequeña…!
Fue lo que parecía hacer, ¡el fluido
agudamente cambio de dirección y limito su ataque a Mamako! “¿¡Porque!?” Fue en
enserio apuntando a Mamako sola.
Aunque Porta y Wise estaban justo al
lado de ella, el fluido parece tener su propia voluntad y se derramo sobre el
cuerpo de Mamako…
“¡Iyan! ¡Por favor perdóname! ¡No más!”
Mamako fue abrumada y tirada en cuatro…
su escasa restante falda fue derretida, su trasero que fue ahora expuesto
estaba encarándole mientras brillaba… ella en verdad vestía una en T atrás. Y
fue un nuevo par.
Aunque fue un nuevo par, está aún
“¡Maa-kun! ¿¡Qué debería mama hacer!?
¡La ropa interior de mama también se derrite! ¡Mama estará completamente
desnuda! ¡Hey Maa-kun!”
“¡Deja de llamarme! ¡No quiero ver
porque estoy en una posición difícil al ser tu hijo biologico!… ¡Kuh! Ese
maldito, porque solo mama…”
Podría ser un pensamiento colectivo
inconsciente. La verdadera forma de aquellas luces que absorbió tal vez tengan
algún tipo de voluntad.
Entre féminas, el número de casos de ser
derretidas las ropas de mama es muy bajo. Si desnudar mamas podría solo pasar
aquí justo ahora… Mama podría ser la prioridad principal…
Oh bueno, tales pensamientos no
“¡Necesito hacer algo rápido! Pero como…
su velocidad de movimiento es demasiado rápida… si pudiera ralentizarlo de
alguna forma…!”
En ese momento.
“¡Supra・La・Magia・Peru・Mirare… Slow
“¡Además! ¡Slow (Ralentizar)!”
Un Chainspell fue casteado contra el
enorme slime. Después la magia de ralentizar movimiento fue usada doble, su
velocidad fue tirada de una sola vez. Esa alta velocidad se había vuelto lenta
y cayó más, y estaba arrastrándose en el suelo.
¿Quién fue la que uso magia? Esa no
podría ser otra que ella. Wise estaba gloriosamente de pie cuando ella podría
estar rechazadamente tirada al lado.
“Tú… como hiciste magia…?”
“Fufun. Un Sabio de alto nivel como yo
puede sobrepsara el efecto de sello de magia con la abrumadora magia en mi
“¡Le pase a ella un objeto de liberación
de sello de magia! ¡Lo siento por hacerlo tarde!”
“¡Ya veo! ¡Buen trabajo Porta! ¡Eres en
verdad una buena niña!”
“¡Hey! ¡En lugar de Porta, deberías
elogiarme a mí! ¡Contribuí justo ahora! Deberías al menos decir algo para mi,
“Estoy también agradecido contigo… ¡si
puedes usar magia, podrías haberlo rápidamente derrotado, gracias por darme la
oportunidad de terminarlo!”
“Ah, maldición…!?”
Masato corrió. Se acercó al enrome slime
moviéndose lento que estaba intentando escapar dentro de la profunda cueva
inmediatamente, y derrotando un monstruo grande tipo jefe como un héroe…
“¡Desnudando una madre en frente de su
hijo de entre toda la gente! ¡Necesitas ser castigado! ¡Eii!”
Sin embargo, Mamako balanceo su Terra di
Madre ante él, causando incontables hojas de piedra que perforaron al enorme
slime. Todas había golpeado al objetivo. Overkill.
¡El absurdamente enorme slime fue
Mamako que deliverdamente dio el golpe
final fue… aun desnuda por ahí, sintiéndose feliz mientras sus grandes y suaves
colinas se sacudían arriba y abajo.
“¡Mira mira, Maa-kun! ¡Mama lo hizo!”
“¡No voy a mirar! ¡Si tienes la decencia
para estar feliz, apúrate y ponte algo de ropa! ¡Date cuenta de las
dificultades de tu hijo!… Kuh, Incluso así… mama aún consiguió la mejor parte
“¡Pupu! Que te sirva de lección. Tú y yo
estamos destinados a tener el mismo fin… ¿Oh?… Hey, hey Masato… mira eso…”
“¿Qué dices? Eso es… ah…”
En frente a donde el dedo de Wise
apuntaba, el enorme slime con su cuerpo entero penetrado por las rocas fue
desapareciendo. Su enorme cuerpo se tornó en polvo negro, grandes cantidades de
gemas fueron tiradas en el punto como si llovieran.
Después que eso desapareció, en ese
lugar, un ataúd que estaba empalado por las hojas de piedra apareció.
Entonces la tapa de ese cofre cayo
fuera. Dentro estaba…
“… Eh… Shirase-san…?”

No hubo respuesta. Parece ser solo un cadáver.

Okaa-san Capitulo 3 (Parte 1)

Capitulo 3: La ropa interior es protectora. El área defensiva tal vez sea grande. ¡De otro modo el hijo morirá!
Una voz estaba intentando despertar a
Masato cuando estaba aún durmiendo. Esa voz no tiene un fragmento de gentileza.
“Hey, levántate ya. Beber la leche de
mama es la primera cosa en la mañana es parte de una rutina del héroe con
mothercon, ¿cierto? Levantate ahora y ve a beber ya. No puedes esperar a ver a
tu mama, ¿cierto?”
Masato continúo cerrando sus pestañas
tercamente. Quien podría levantarse en aquellos tipos de palabras…
“Aah ya veo. ¿Puedes ser el tipo que no
se levanta hasta conseguir tu favorito beso mañanero de mama? Entendido.
Entonces iré a llamar a Mamako-san por ti.”
“¡Oi, no hagas nada innecesario! Mama
será seria si lo haces…!”
Para prevenir que la llamen, él
apuradamente se levantó, pero *¡Bang!* “Tsuu…!?” Masato golpeo algo duro con su
cabeza de repente.
“Qué demonios… huh… ¿eh?”
Estaba completamente negro al abrir sus
ojos. Volteando alrededor ligeramente, sintió algo duro encarcelando todo su

Parece que estaba en una caja… no había
salida, así que solo empujo contra la oscuridad ante sus ojos mientras
recargaba su espalda, el espacio ante sus ojos sorpresivamente se abrió al
Como se sentó, Masato vio que estaba
dentro de un ataúd.
“… Erm… porque estoy siendo tratado como
un muerto… esto es…?”
Él recordó. Fue ayer, después que Wise
se volvió su compañera, ellos habían hablado sobre quedarse en la posada.
sobre decidir que deberíamos compartir cuartos con quien, no es así…
Los cuartos en esta posada eran todos
dobles. Después que Masato rechazo compartir cuarto con Mamako, y también ser
rechazo por todas por una lamentable razón cuando sugirió compartir habitación
con Porta… fue zanjado que Masato se emparejaría con Wise en compartir
Después que terminaron su comida en la
posada, cuando Masato iba a entrar a la habitación.
“¡Supra・La・Magia・Peru・Mirare… Death
Él cayó cuando escucho una voz, algo
repentinamente penetro su cuerpo como un shingami, y Masasto perdió su
conciencia pronto después de eso. ¡Eso
es! ¡Ese es definitivamente el caso!
Esa era exactamente la causa de la
situación actual.
Teniendo tal convicción, Masato miro a
la chica que estaba sentada en lujos en la cama combinada de dos camas.
“Oi. Me hiciste muerte instantánea,
“¿No está bien? Ya que reviví
Esta era, la Sabio Wise, que tenía el
poder mágico y técnica para usar ambos, magia de muerte instantánea y magia de
“Más bien, ¿Por qué no te afecto? ¿No se
supone que iras directo a la cárcel por la penalidad de PK? Tú criminal.”
“Se supone que ese sea el caso.
Honestamente hablando, también pensé [¡Oh no!], pero la penalidad no se activó.
¿Quizás la penalidad solo pasa en el campo? O tal vez no aplica en compañeros.
Más bien, soy suertuda.”
“Muy bien, lo tengo, iré a reportar esto
como un bug.”
“Hey, no hagas eso. Es absolutamente
necesario para mí proteger mi castidad… A regañadientes di un OK ya que no
había otra elección, pero es imposible para mí dormir en la misma habitación
contigo después de todo. No puedo dormir plácidamente después de todo. Es solo
como una damisela arrojada en una jaula con una bestia.”
“Has estado tratándome sin parar como un
mothercon todo este tiempo, solo en qué momento me has tratado como un hombre
“Eso es eso, esto es esto… Más bien, en
lugar de hablar sobre eso, apúrate y alístate. Mamako-san dijo que hará el
desayuno después de levantarte. Ya estoy lista y esperando. Así que apúrate,
Wise bajo de la cama como eso, y urgió
[Apúrate y ve a lavarte la cara] con su pie señalando “Shoo shoo” a alejarme.
Sin embargo, esa postura causo que su falda ondeara, y el interior fue
“Ok ok lo tengo… geez… repentinamente
matándome… No hare nada… no tienes ese valor. Ni encanto del todo. Nada que
mirar además. Estúpida.”
“¿Acaso dijiste algo?”
“Nada. Geez.”
Él no podía evitarlo sino enojarse, pero
primero, debería lavar su rostro y refrescarse a si mismo.
Masato entro al lavabo que era también
el baño [Baño completo estilo occidental]. En la habitación que tenía un
lavabo, un baño, y una tina diseñada para adecuarse, una fragancia de jabón
sobre salía, Wise probablemente tomo una ducha justo ahora…
En la soga que se estiraba desde el
final de la pared del otro, colada estaba colgando para secarse. Era toda la ropa
interior de la doncella del valor de cinco días.
“S-si ella es consciente de mi como un
chico, entonces se cuidadosa sobre tales cosas… geez… son definitivamente
divididos de acuerdo a los días de la semana[1]… Qué día de la
semana es negro para…”
“Acaso decías algo… huh…
Ella salto fuera de la cama, pisando
fuera y rápidamente mirando bajo de todo.
Wise ladro con un rostro sonrojado tan
roja como tomate. [Kiel: Si, dice ladró… yare, yare…]
“¡Sa-salir de viaje significa este tipo
de cosas!”
“Ah si si. Ya veo.”
“¡Incluso esa heroína conocida tuya
también, cuando nos quedamos en una posada, ella podría rápidamente lavar sus
pantis en el lavabo y secarlas en el cuarto! ¡Si no, podría significar que ella
solo vestía las mismas pantis por días en el viaje!”
“¡Oi tú! ¡Para de hacer ese discurso que
quiebra el sueño de los adolescentes!”
[Kiel: Supongo que se refiere a Porta…]
Un viaje actual tiene varias
“Ahora bien, todos aplaudan con sus
manos… itadakimasu.”
“Muy bien, ahí. Disfruten la comida.”
El primer piso de la posada operaba como
un restaurante para aventureros para comer en la mañana y la noche.
Alineados en la mesa había palillos,
arroz, huevo, sopa de miso, pescado asado y tsukudani[3]. Era un
desayuno hecho a mano por Mamako.
Mirando fuera de la ventana, guerreros
en armaduras y hechiceros sosteniendo báculos pasaban naturalmente. Viendo ese
tipo de escenario junto con un desayuno japonés de alguna forma se sentía mal.

Bueno, lo que sea.
Masato parece estar en un modo relajado.
La razón fue ese desayuno, especialmente la sopa de miso.
Usualmente era, beberlo rápidamente, sin
dar una espera para degustar el sabor, pero claramente entendió. [Eso es esto]
[Es como siempre] [El sabor de mama] eso fue.
Sin una duda, podría dar bienvenida a la
primera mañana en este mundo RPG con la usual atmosfera gracias a este desayuno
que fue hecho por Mamako.
“¿Como esta, Maa-kun? ¿Es delicioso?”
“¿Eh?… Ah, bueno… Es más o menos
“Mama agradece escuchar eso. Traer miso
y dashi conmigo fue la elección correcta. Mama creía que si íbamos a vivir en
un entorno diferente del usual, este aspecto es lo más importante. Los gusto de
Maa-kun hacen a mama feliz…”
“¡Tama kaken gohan[4] y sopa
de miso de algas es en verdad demasiado! ¡Soy tocada después de encontrar mis
raíces después de un largo tiempo! ¡Uuu! ¡Mis lágrimas solo! ¡Mis lágrimas no
“¿¡W-Wise-san!? ¿¡Estás bien!?”
“Que ruidoso… come tu comida
“¡Ah geez, ah geez! ¡Me quitaron mis
zapatos! ¡Estoy comiendo en seiza[5]! ¡Saboreare esta comida incluso
si mi pie se entume!”
“Entonces ya que es tal rara
oportunidad, tal vez mama debería también sentarse en seiza. En la silla mama
ira, heave-ho”
“¡Yo también me siento en seiza!
“Geez, perdóname de eso… de donde son
todos estos turistas japoneses… heave-ho.”
[Kiel: Desconozco el sentido/significado
de la frase, la deje en ingles pues su traducción es sin sentido… cielo-ho…
El héroe japonés sentado encima de la
silla en agura[6] mientras refunfuñaba. No se podía evitar ya que él era
japonés también. Solo no podía evitarlo.
El desayuno termino como tal.
Después de la comida. Mientras sorbía el
té verde que Mamako sirvió, ellos discutieron los planes de hoy.
“El equipo consistirá en nosotros cuatro
por el momento a ser. Porta es una no-combatiente, así que se volverá una pelea
de tres personas… incluso sin un defensor, siento que con mama enfatizando el
ataque a todos los objetivos al mismo tiempo cuando la pelea comience,
funcionara de alguna forma.”
“¡Deberías confiar en mí, que es un
Sabio en su lugar! ¡Ataca, recuperación, apoyo, puedo dejar todo a mí! ¡Puedes
esperar un montón de mi magia también! ¡Fufun!”
“Si si eso es verdad… Con eso hecho, la
siguiente cosa después buscar por compañeros es…”
“¡Por supuesto, son compras! ¡Compras!
¡Compras!” [TLN: La ultima ‘compras’ fue recitada en Ingles ya que Mamako es
una ama de casa, y una ama de casa solo le da hype por ir de compras.]
Mamako que estaba sosteniendo el libro
guía en su mano hablo con una voz energética.
Ella era inusualmente motivada. Un aura
que podría ser visible emanaba desde ella. Super Mamako.
“No simplemente comprar, necesitamos
comprar cosas que aumenten nuestros estatus…”
“¡Hoy vamos a comprar por el día entero!
¿¡Ahora que debería mama ir y comprar!?” *Salto salto☆*
“Son protecciones, por supuesto. Mama y
yo vestimos nuestras ropas usuales. Primero sería armadura de…”
“Ah. Es cierto, es cierto. Mama olvido
traer protector solar. ¿Hay alguna farmacia alrededor de aquí? El tónico de
Mama también tiene poco restante… ¡Ah, crema de manos!”
“RPG no tiene cosas como esas. Rindete.”
“Pero, mama no tendrá la confianza en
salir fuera nunca más si mama no cuida de su piel… mama también no será capaz
de girar a monstruos y mostrar su rostro.”
“¡No hay necesidad de preocuparse sobre
la mirada de los monstruos cuando peleamos! ¡Sin mencionar que mama tiene una
piel por default -20 de edad, así que no importa!”
“¡Creo que quiero a la linda Mama-san a
siempre continuar linda! ¡Además, creo que comprar propiamente cosméticos es
“Cosméticos son una necesidad, ¿no es
así? Quiero decir, no eso hará que el valor de odio hacia Mamako-san caiga?
Siento que tal linda persona no será herida, también apoyarla comprando
cosméticos. Si encontramos una tienda vendiendo extensiones de pestañas, los
comprare inmediatamente.”
“Que con extensión de pestañas… qué tipo
de RPG hacia eso… no se supone que esto es un RPG de espadas y magia…”
¿Qué podría ser esto? Palabras de la
realidad que no deberían estar en este mundo imaginario de fantasía fueron
intercambiadas. “¡La farmacia debería ser primero!” “¡Si!” “Ah, necesito crema
labial.” Solo las féminas estaban excitadas. No había una abertura para un
hombre ahí. Masato ya era casi como no estuviera ahí…
Cuando repentinamente, Wise elevo su
“Hablando de eso, ¿qué es lo que
“¿Hmm? ¿Sobre qué?”
“¿Cuánto dinero tienen ustedes chico?”
“¿Dinero? No tengo nada… ¿acaso mama
tiene algo?”
“Por supuesto. Mama trajo todo los
ahorros secretos.”
Diciendo así, Mamako tomo su cartera con
gran confianza. Ella la abrió para mostrarles.
Dentro, diez billones de yenes japoneses
estaban atascados juntos… Wise y Porta fueron ligeramente problemáticas.
“Ah, erm… no puedes usar dinero real
aquí. Esto es dentro de un juego.”
“En un juego, no puedes usar dinero
aparte de la moneda actual en juego. Además, no puedes comprar cosas con aquel
“Eh… emm…”
Mamako se espacio por un momento, ¡pero
ella no se rindió! “¡Entonces sobre esto!” ¡Mamako saco el cupón nacional de
arroz! Sin embargo, Wise sacudió su cabeza. “¡En ese caso!” ¡Mamako saco el
cupón nacional de cerveza! Sin embargo, Porta sacudió su cabeza disculpándose.
“Erm… M-Maa-kun…”
“Ríndete. Solo significa eso.”
La madre e hijo sin un centavo bajaron
sus cabezas.
“¡Lo siento! ¡Pensar que Porta-chan
tenía que pagar la posada primero! ¡Regresare el dinero usado tan pronto como
sea posible!”
“¡Por favor no se preocupe por eso! ¡Soy
la compañera de Mama-san y todos, así que mi dinero es también el dinero de
todos! ¡Estar agradecida de ser capaz de usarlo!”
“¡Deja de decir tales palabras lindas
ya! ¿¡Solo que tan buena niña Porta puede llegar a ser!? ¡En verdad voy a
abrazarte, tú pequeña!”
Ellos no podían comprar nada sin dinero.
Ellos no podrían pagar por los servicios provistos. Ellos no podrían hacer nada
sin hacer lo anterior a eso. No podrían obtener dinero sin hacer algo.
¿Cómo podría un aventurero obtener
dinero? Había solo una respuesta. Peleando.
El equipo de Masato estaba caminando
fuera del pueblo buscando por enemigos.
“En ese caso, vamos a derrotar tantos
monstruos como podamos primero. ¡Eso debería ser por ahora!”
“¡Si! ¡Después de derrotar un monstruo,
las células especiales en su cuerpo continúan sin desaparecer! ¡Es llamado
[Gema], pero esa gema tiene diferentes tipos como combustible y material, así
que podemos recibir dinero por el intercambio en el centro por esto! ¡Es así
como consigues dinero a través de pelear!”
“Es más como, ¡Esas son las bases!
¿¡Porque no las sabes!? ¡Aquellos agentes comisionados te debieron explicar!”
“¡Quien estaba a cargo de nosotros es
una persona problemática que no me informo que debería ser informado!”
Shirase que estaba en algún lugar
estornudo… no, ella no era tan persona sensitiva. Ella probablemente no se
cuidó. Ya que es ella Shirase. [Kiel: Me siento mal por tanto mal chiste…]
“¡Por favor déjenme la reunión de gemas
a mí! ¡Ya que no puedo tomar parte en la batalla, daré lo mejor en recolectar
gemas! ¡Pondré mi honor como mercante viajero, no dejare una sola gema que vale
algo de dinero!”
“¡Muy bien, dejaremos eso a Porta! ¡Mama
y yo nos concentraremos en pelar!”
“¡Entendido! ¡Vamos a madre e hijo
combinar nuestras fuerzas y trabajar duro!”
“¡Espera, estoy también aquí! ¡Por favor
también confían en mi magia!”
“¡Por supuesto planeo hacer eso! …
En frente de los pastizales que pasan a
través, múltiples sombras estaban entre las brechas del bosque. Al otro lado
probablemente también los notaron. Siluetas de lobos y osos se movieron fuera
La primera en cortar fue Wise. Ella
rápidamente volteo las hojas después de traer fuera su grimorio.
“¡Adecuar mi fuerza primero! … Supra・La・Magia…”
“¡Mama no dejara a su hijo estar en
problemas por vivienda! ¡Mama trabajara duro! ¡Eii!”
Wise estaba en el intento de atacar
antes, pero Mamako consigue la premisa. Su Espada Sagrada de la Madre Tierra Terra
di Madre fue balanceada.
[Kiel: Antes de darme cuenta… le
cambiaron el nombre, en ingles esta escrito Terra di Malote antes…]
El ataque de Mama llama la fuerza de la
Madre Tierra, haciendo incontables hojas de piedra salir desde debajo de los
pies de los enemigos. Siguiendo un magnifico ataque a todos los objetivos, el
grupo de monstruos fue perforado a través y destruido en un instante.
¡El grupo de monstruos fue destruido!
“Espera… aunque estoy aún en medio del
canto… o más bien, que fue eso… el poder de fuego de Mamako-san no es una broma
del todo…”
“Te tardaste huh. La próxima vez,
comienza a cantar antes… Esas parecen ser varias cosas como dados girando en el
lugar donde los monstruos estaban, ¿podrían ser aquellas gemas?”
“¡Si! ¡Entonces déjenme recolectarlas!
¡Por favor espere por un momento!”
La pequeña Porta corrió alrededor
ágilmente, recogiendo aquellas gemas girando coloridas. Esa figura era justo
como una linda pequeña ardilla reuniendo nueces de árboles en un sueño.
“Entonces déjame alimentar a Porta después de que termine de recolectar.”
“Maa-kun…” Madre lo observaba con ojos tristes.
Y entonces.
“¡Maa-kun! ¡Hay algo moviéndose en la
sombra del árbol de ahí!”
“¿¡Que dices!? … ¡Oh, parece ser una
sombra como monstruo que ahí estaba!”
“¡Ok, déjamelo a mí! ¡Esta vez de
seguro!… Supra・La・Magi…”
“¡Mama no perderá! ¡Eii!”
La primera en moverse fue Wise, pero el
resto fue omitido.
De frente a la sospechosa sombra del
árbol, Mamako balanceo su Espada Sagrada de la Madre Mar Altra.
Agua desbordo desde el camino de la
espada, volviéndose incontables balas y salieron disparadas al mismo tiempo.
Aquellas enormes hormigas, arañas y ciempiés que solo mostraron sus figuras,
fueron ahora perforados con hoyos y colapsado.
¡El grupo de monstruos fue derrotado!
“… M-mira ahí… mi magia necesita ser
cantada para…”
Y Wise estaba diciendo algo, pero en ese
momento, un timbre repentino resonó, una pantalla salió en frente de Masato y
Mamako. Las palabras [¡Level up!] saltando fuera.
“Oh. Subir nivel se siente como esto
huh… heh… HP y MP, junto con otros estados base automáticamente incrementando…
SP recibidos… Fumu, fumu, gastar los puntos llamados SP para crear mi propio
estilo o algo como eso huh.”
“Oh mí, son puntos. Mama ama los puntos.
Mama los guardara por el momento.”
“Oi la persona de ahí. Estos puntos no
son los puntos que pueden ser intercambiados por cupones de tiendas o premios,
¿sabes? Necesitas propiamente asignarlos en tu estado… aah, no, tal vez
guárdalos ya que puedes aprender una habilidad especial… ahora no puedo
“Decidir en cómo usar tus SP puede
esperar para luego, escucha lo que dire primero. Tengo un tiempo de casteo, eso
quiere decir que necesito tiempo de preparación, así que necesito un poco de
tiempo antes de que mi magia se active…”
Wise estaba diciendo algo, pero una vez
más, ¡todo fue repentinamente en un momento!
“¡Maa-kun, mira arriba!”
“¡Ooh, hay un monstruo en el cielo
también huh! ¡Aunque es solo uno!”
“¡Muy bien, las espadas no pueden llegar
al cielo! ¡Es mi turno! … Supa…”
“¡Déjame el enemigo el cielo a
Sobre Wise, ya no importaba.

Masato empuño su Espada Sagrada del
Cielo Firmament calmadamente. Este fue el único lugar que podría ser activada.
Esto era algo que definitivamente no podía retener. Él puso todo su cuerpo y
alma en esto y balanceo su espada. La hoja transparente libero un tajo que
brillo hacia el cielo.
El tajo auto-dirigido “¿¡Piyo!?” golpeo
al monstruo enemigo tamaño loro, cuyo nombre era también Piyotan, y derrotado.
¡Un monstruo fue derrotado!
“¡Lo hiciste, Maa-kun! ¡La fuerza de
Maa-kun impresiona a mama! *Good job☆”
“Kuh… no llores… no hay punto en llorar…
Perderé si me comparo a mama por mí mismo.”
“¡Lo siento por tenerlos esperando! ¡He
recolectado todas las gemas! ¡No he dejado ni una detrás!”
“¡Muy bien! ¡La próxima vez de seguro!
¡La próxima vez cuando enemigos dominen en el cielo, jugare un rol activo! ¡No
ganare debido a la fuerza de mama, obtendré la victoria con mi propia fuerza!”
“Ufufu, tan confiable. Entonces vamos a
“¡Si! ¡Vámonos!”
Quitándose las pequeñas gotas de
lágrimas, Masato comenzó a correr. Mamako miro la confiable figura de su hijo
como elevaba su espíritu, Porta estaba también llena de motivación para
trabajar duro, el grupo del héroe se movió delante para mirar por más enemigos.
Sin embargo, había una persona.
“… Yo… soy innecesaria en este equipo…”
La inteligente Sabio que noto que tal
vez no tenga turno después, estaba de pie en el punto mientras miraba hacia el
suelo con ojos que parecía que buscara la razón para existir.
Ante los pastizales, había una colina
con una buena vista. El grupo siguió la sugerencia de Mamako y tomo un descanso
“Muy bien, todo el mundo. Vamos a tomar
un descanso aquí.”
“¡Si! ¡Vamos a tomar un descanso!”
“Primero pienso que el héroe, ese sería
yo, debería decir eso pero… lo tengo. Descansare por un poco.”
Sea en batalla, o haciendo decisiones
como eso, él podría no negar que sentía de alguna forma insatisfacción de
Mamako que era de alguna forma más sobre saliente que él, pero… él suprimió esa
irritación en su corazón por ahora. Él dejo a su mente descansar también.
Aunque, mirando de cercas, él pudo solo
ver a tres personas. Wise no estaba a la vista.
“No puedo encontrar su escondite… ella
no pudo hacer una cosa sola así…”
Fue simpatía por estar en los mismos
zapatos, o él estaba lamentando sobre su madre siendo solo demasiado fuete, o
más bien se sentía mal por ella. Fue de disculparse también, Masato busco por
Él dejo la sombra del árbol por un
momento desde la colina donde Mamako y Porta estaban felizmente charlando. Él
predijo que una persona retorcida y rebelde como ella podría probablemente
estar alrededor si miraba, ella era así.
Bajo la sombra de un árbol, Wise estaba
llorando con sus hombros temblando…
“Kukuku. Continua luchando, tú insecto
indefenso. Vamos vamos vamos vamos vamos.”
Él era fuerte. Las hormigas bajo sus
pies estaban siendo retrocedidas y jugando alrededor de una rama del árbol. Fue
una preocupante condición en otro sentido.
Masato se acercó a esa Wise… por
supuesto, manteniendo una adecuada distancia.
Wise le ignoro primero, pero ella
suspiro, y arrojo una pequeña rama a los pies de Masato.
“… ¿Qué es lo que tienes?”
“Esa es mi línea… Si tienes algo que
decir solo dilo. Vamos, apúrate y dilo. ¿No está bien ser estúpida? Lo siento
por ser una Sabio inútil. ¡Hmph!”
“Ser inútil es un hecho pero… bueno, uh,
como ponerlo… no ser tan consiente sobre esto.”
“No es posible. Mi orgullo ya está roto.
No puede ser recuperado.”
“Eso no tienes que decirlo… aah, es
cierto. Aquí.”
Masato ligeramente enrollo su manga.
Había un ligero arañazo en su brazo.
“Parece que de alguna forma me herí, ¿puedes
hacer algo sobre esto? Es un poco doloroso.”
“¿No estaría bien si dejas a tu mama
favorita a que lo lama? Ella se ve tan joven, tal vez ella posee la habilidad
de regeneración de piel.”
“Ella no posee tal cosa. Como esperaba
mi mama no es ese tipo de super humano.”
“Entonces puedes solo tener una medicina
de recuperación de Porta. No hay necesidad de usar mi magia, cierto… Intentar
animarme como eso es inútil. Deja de pensar tales cosas. Hmph.”
El humor de Wise empeoro, y desvió la
mirada de él.
tratada mi herida con tu magia, es genial tener a Wise con nosotros después de
Algo como eso, parece que no lo hizo
bien. Ese plan de ánimos fue una falla… entonces.
“… Muéstrame.”
Mientras daba la cara a otro lado, Wise
pincho y jalo las ropas de Masato.
“¿Qué? ¿Vas a tratarme?”
“Ustedes chicos no tienen dinero,
¿cierto? Solo pensé que usar un objeto en este nivel de herida es un malgasto
de dinero. En otras palabras, ineconocimco. En ese caso, umm… usar el método
más económico efectivo es la mejor elección…”
“Eso quiere decir, ¿tratarme con tu
“¡T-te diré esto primero! ¡No es que
este así por venir a animarme, solo pensé que al menos completare mi rol!
¡Vamos, apúrate y muéstrame tu brazo!”
“Si si. Entonces confiare en ti.”
[Kiel: Tsundere… tsudere… tsundere…]
Esa chica deshonesta. Él pensó que ella
tal vez era ese tipo de persona, y fue justo como él pensó después de todo.
Masato mostro su brazo en frente de Wise mientras sonreía amargamente.
Y entonces Wise saco su grimorio,
cantando su hechizo. Ella activo su Chainspell.
“¡Supra・La・Magia・Peru・Mirare… Vent・Tario
[Viento Severo]!”
“¿¡Ugyaaaaaaaaaaaaaaaaa!? ¿¡Mi brazo
esta severamenteeeeeeeeeee!?”
“¡Además! ¡Cura [Recuperación]!”
“Ah, reconectado.”
El brazo de Masato fue cortado por una
hoja de viento y entonces restaurado. Impresionante.
[Kiel: o tal vez no]
“Fufun. ¿Cómo es mi verdadera habilidad?
Di lo genial que es con todo de ti después de todo.”
“En verdad no quiero decirlo. Es más
como quiero protestar ampliamente contra eso… O más bien, ¿Por qué la penalidad
no se activó? Tú totalmente me atacaste justo ahora, ¿no es así? Eso está
fuera, es un bug…”
“Hmm, ¿no es porque no puede determinar
entre compañeros después de todo? Siento que es como eso.”
“Ah, ese tal vez sea el caso. Porque es
debido entre compañeros, eso es.”
Entre compañeros. Él a propósito
enfatizo aquellas palabras, y Wise débilmente abrió sus ojos ampliamente “…
Hmph”, y desvió su mirada.
Wise se había puesto avergonzada, sus
orejas eran ligeramente teñidas de rojo, pero él pretendió no verlo.
“De todos modos, solo anímate y ven. No
eres la única que perdió contra la fuerza de mama. Deseo trabajar duro.”
“Trabajar duro dices… haa… bien es
cierto. Sigilosamente subir nivel, sigilosamente conseguir SP; sigilosamente
elevar estado y habilidades por usar aquellos puntos… no hay otra manera.”
“Es como eso. Podemos hacer solo una
vida sin costos real en el juego. Solo para volverse el atacante principal un
día, podemos solo continuar hacer esto sin descansar… Como tal.”
Masato empujo su puño hacia Wise. Vamos
a trabajar duro. Wise mirándolo en una manera como si ella admitiera su derrota
hacia el sentimiento del hombre, pero pensó que tal cosa no era tan mala.
Wise también ligeramente puso su puño…
golpeando su puño con la intención de ser compañeros… pero antes de eso.
El suelo se sacudió.
“Oi, esto es, eso…!”
“No me digas, de nuevo…!?”
Inmediatamente después, la habilidad de
la Madre Tierra, la habilidad de apoyo [Colmillo de Madre] que podría detectar
la ubicación del hijo e interrumpir la situación exploto, aquellos dos fueron
apartados y lanzados fuera.
*Gira gira salta* su rastro aéreo fue
formando exactamente el contorno de un corazón…
No, fue solo una imaginación. Ese tipo
de cosas no puede ser posible.
[1] Semana Japonesa – Los siete días de
la semana en Japón son nombrados como los cinco elementos + luna y sol, cada
uno representa un diferente color. http://www.punipunijapan.com/wp-content/uploads/2012/11/meanings.png
[2] Itadakimasu – Gracias por la comida.
Cortesía japonesa que es dicha antes de comer para agradecer al chef, mientras
Gochisosama es dicho después de la comida que también significa agradecer por
la comida.
[3] Tsukidani – Un tipo de platillo
adjunto servido. https://en.wikipedia.org/wiki/Tsukudani
[4] Tama kake gohan – Literalmente huevo
sobre arroz. Un platillo de arroz japonés que ponen huevo crudo sobre arroz y
mezclarlo antes de comerlo. http://www.seriouseats.com/images/2016/04/20140416-tamago-kake-gohan-recipe-16.jpg
[5] Seiza – Una manera forma de sentarse
en Japón. Usualmente usada en ceremonias del té, encuentros formales
tradicionales, y modernamente usado como una forma de castigo.

[6] Agura – Una manera de sentarse. https://en.wikipedia.org/wiki/Agura

Okaa-san Capitulo 2 (Parte 4)

Capitulo 2: Es solo una coincidencia que sean solo chicas.
No me malinterpreten. No me miren con esa sonrisa.
En la prisión subterránea del Pueblo
Kassan. Después de llorar por un largo tiempo en prisión, Wise miraba abajo
como si todo hubiera terminado.
Ella pretende así, entonces golpeo las
barras de hierro con una fuerza furiosa, y ladro a Masato que estaba mirándola
con una mirada despreocupada.
“¡Esto no esta bien! ¿¡Hey, esto no es
extraño!? ¿¡Porque soy arrestada!?”
“Parece que has sido juzgada por haber
cometido intento de PK a mi.”
“¿¡Hah!? Estas mintiendo, ¿¡cierto!?”

PK era sobre asesinar un jugador, y
atentar a hacer eso. En otras palabras, Wise estaba en el estado de atentar a
asesinar a Masato.
“¿Es ese el caso, Shirarase-san?”
“Si. El dato dejado indica que el ataque
de Wise-san ha reducido el HP de Masato-kun a condición fatal… Masato-lun es
aún nivel 1, y no vestía algún equipo protector, incluso un ataque físico de
una profesión mágica puede fácilmente provocar la fatalidad.”
“Ese es el caso. Fue sobre ‘eso’ de
“Así que fue ‘eso’ de antes huhhhh…
¡P-pero! Chocamos manos y nos volvimos compañeros, ¿¡no es así!? ¡Fue en verdad
un buen sentimiento! ¡Así que debería evadir la penalidad debido al
establecimiento o algo así! ¿¡No es eso bueno!?”
“Hmm, bueno, siento que hice algo como
eso, pero…”
Desafortunadamente, debido a la
habilidad de su madre, sus intercambios de promesa no fue establecido, pero la
intención de Masato y Wise de volverse compañeros no fue mala. Fue claro que no
sostenían algún rastro de enemistad contra el otro. Estaba bien a seguir el
deseo de Wise.
Sin embargo, él decidió esperar en su
lugar. Él tenía pocas cosas que decir.
“Wise-chan. ¿Puedes darme un momento?”
“¿¡Qué es lo que quieres ahora!?… Ah,
no eso, ¿¡q-q-que es lo que necesita, madre Mamako-sama!?”
“He escuchado tu plan de Maa-kun. Así
que pensé sobre eso… después de todo, deberías no tener esas extrañas ideas y
honestamente reconciliarte con tu mama…”
“¡Eso es absolutamente irrazonable!”
“No digas algo como eso… ¿Okay? Por
favor date un poco para pensar.”
“¡Lo irrazonable es irrazonable!
¡Imposible! ¡Reconciliarme con ese peor tipo de persona es imposible!
¡Comparada a reconciliarme con mama, destruir este mundo podría ser mucho más
“Oi espera. En tales momentos, no
deberías decir, ‘Morir es mucho más fácil’ ¿en su lugar?”
“¿Hah? ¿Por qué tendría que morir? ¡Eso
podría hacerme ver como perdí con mama! ¡Eso definitivamente me molesta! … ¡Me
volveré la única que sobreviva hasta el final! ¡Y usare cualquier medio
necesario para hacer que mi plan funcione! ¡Kukuku, hah hah hah!”
Ella dice así como muestra su rostro
“Teniendo el vigor para sobrevivir como
alta prioridad. Arrojando tu vida fuera fácilmente cuando encuentras algo que
odias no es bueno.”
“¡Si! ¡Soy ese tipo de chica! ¡Soy una
asombrosa chica que firmemente sostiene su fe en ir contra su mama en mi
corazón! Es por eso, así que… aah, lo que sea, todos esos actos de niña de buen
corazón son demasiado problemáticos así que lo soportare, ¡hazme la hija de
Mamako-san! ¡Por favor! ¡Te lo imploro!”
Wise toma sus manos juntas y baja su
cabeza. Ella es una Filosofo Japonesa que es conocida con modales Japoneses.
A pesar de ser tratada como una
diosa/buda Mamako-sama, Mamako no lo aceptara.
“No. No puedo dejar a Wise-chan volverse
mi hija.”
“Por favor encuentra una manera…!”
“Sin embargo, agradecidamente te dare la
bienvenida a ser nuestra compañera y aventurero juntos.”
“¿Hah?… Eh… ¿Qué es lo que eso
“Bueno puedo más o menos imaginarlo. En
resumen, primero traerte junto a nosotros, entonces encarar este asunto con tu
mama durante nuestro viaje, y actuar como chaperones para hacer que se
reconcilien, ¿correcto?”
“Gran respuesta. Mama y Maa-kun son en
verdad mama e hijo después de todo. Leemos la mente uno del otro.”
“¡E-espera un minuto! ¡Qué con eso! ¡No
les pedí eso! ¡Si eso es como va ser, entonces retracto mi solicitud! ¡No me
volveré su compañera!”
“Ah, ¿es eso así? Entonces es una
lástima, nos separaremos aquí.”
“Da lo mejor con la restricción de
penalidad por intento de PK.”
“Respecto a la penalidad, es
experimental, así que usaremos la actual ley criminal como referencia para
configurarla. Sera una detención de quince años, por favor tomen cuidado.”
“¿¡Ueeeeeeeeeeh!? ¿¡Eso es demasiado
De acuerdo a la ley criminal de Japón,
la penalidad por herir a alguien era [Encarcelamiento por quince años o menos o
bien cinco mil millones de yen o menos].
Si Wise no quiere recibir la penalidad,
ella podría solo elegir aceptar.
“Kuh… en ese caso, no tengo elección
sino aceptar sus condiciones, cierto…”
“Solo será una mediación a medias. No
hare algo como forzarte a reconciliarte. Eso es como debe ser, ¿esta bien?”
“Gunununu… sin embargo, eso es…!”
Mamako intentó persuadir a Wise con su
sonrisa juvenil, pero llena de amor maternal. Sin embargo, Wise parece estar
vacilando en tomar ese paso. Ella necesita un empuje más, algo que sea
necesario. En ese caso.
“Escucha, Wise.”
“Si tenemos tu asombrosa magia, podría
ayudarnos un montón. Además, creo que en la cuenta de tu asistencia, esto es
“Estas diciendo que mi fuerza es crucial
para ti, ¿¡cierto!? ¡Fufun! ¡Si dices algo como eso, entonces no se puede
evitar! ¡Entiendo! ¡Me volveré su compañera!”
“Santo cielo, que fácil persona…
Entonces, por favor cuidad de mi desde ahora.”
Por mostrar un poco de admiración por
ella, ella fue fácilmente manipulada eso fue divertido.
Filósofo Wise se vuelve su compañera.
Masato y compañía dejaron la prisión
después de añadir a Wise como su compañera. Ellos caminaron hacia la calle que
fue bañada en el color naranja desde la puesta del sol.
“Geez… esto es totalmente diferente de
mi plan… porque esto…”
“Esto es porque no tienes la fuerza
actual para llevar a cabo tu plan. Que lamentable Filosofo eres.”
“¡Tú, callate! ¡Tú también eres solo un
héroe inútil que no tiene poder para decidir! Incluso en términos de poder de
fuego, Mamako-san es mejor, ¿¡cierto!? ¡Mamako-san es la que me invito a ser
una compañera al final! ¡Tú a lo mucho no hiciste nada!”
“Guh, n-no lo digas como eso… también
secretamente estoy al tanto sobre eso… incluso solo pensé que no debería ser el
único que tomo el escenario trasero entonces… *Gusun*”
“No te preocupes. Mama entiende los
sentimientos de Maa-kun y solo hablo por ti. Leímos la mente del otro.”
Ellos charlan mientras caminan.
Shirarase repentinamente se detiene.
“¿Hmm? ¿Qué pasa?”
“Lo siento, pero discúlpenme por irme de
aquí. Recabar la progresión de la famliar Oosuki, y también la situación de
Porta-san y Wise-san, tengo que, más o menos, dar un reporte a mis
“Ah bueno, ¿tienes que llevar a cabo tu
deber desde ahora? Trabajar es muy cansado, ¿no es así?”
“Totalmente. Pero es para mis costos de
vivienda para mi familia. Ahora bien… ah, antes de eso… Wise-san, y Porta-san
también, ¿puedo tener un poco de su tiempo? Tengo algo que decirles a ustedes
“¿Eh? Si es lectura, entonces por favor
“¡S-sí! ¿¡Qué podría ser!?”
De cara hacia la inestusiasmada Wise y
la atenta Porta, Shirarase les dijo sus problemas.
“Creo que deberían entenderlo sin tener
que repetirlo por mí misma, respecto al tratamiento con ustedes dos, son
jugadores de prueba que han sido especialmente permitidas a mantenerse en este
mundo. Por favor no olviden eso.”
“¡Si, no lo olvidare!”
“Si si, lo tengo. Lo tengo ya.”
“Especialmente para Wise-san, por favor
aprende de tus benefactores de Mamako-san y Masato-kun como padre e hijo. Creo
que necesitas trabajar duro para reparar tu relación padre-hijo. ¿Es claro?”
“… Odio ese tipo de cosas… quien podría
hacerlo con esa estúpida madre…”
“¿Acaso dijiste algo?”
“Noo. Ok ok lo gento, trabajare duro.”
“Santo cielo… no parece entenderlo para
nada, pero… considerando el tiempo extra y esfuerzo tal vez necesite gastar
tiempo de mi deber de trabajo en JK, discúlpenme a mi misma.”
Diciendo sus sentimientos honestos con
un rostro serio, Shirarase se fue, “E-esa persona es demasiado honesta…” “Yo
creo que ella es asombrosa, en varios sentidos” Masato y compañía sonrieron
raramente como ella se fue.
Ahora bien.
“¿Así que? ¿Qué haremos desde ahora?”
“Ya es de noche, mama tiene que hacer la
cena ya.”
“Fuun… ¿Dónde?”
“Donde preguntas, eso es por supuesto en
la cocina de nuestra casa…”
“Estamos actualmente en el medio de una
fabulosa aventura dentro del juego. No hay tal cosa como una casa o parecido.”
“¡Ah, eso es cierto! ¡Estamos
actualmente de aventura!… Entonces, em…”
Mamako inmediatamente reviso el libro
guía, entonces *destello* lo encontró.
“¡Vamos a quedarnos en la posada! ¡Ha
sido un largo tiempo desde que mama estuvo sobre el mar! ¡Mama puede sentir su
corazón acelerado!”
“No creo que sobre el mar se la manera
correcta de decirlo, pero bueno, es verdad eso. Deberiamos ver por una posada
“Donde podría estar la posada… para
mama, está bien saltarse hacer la cena, pero mama propiamente hará el
“¿¡Deberías dejar a la gente en la
posada hacer el desayuno!? Eso debería ser más divertido, ¿cierto?”
“No. Mama no puede permitir eso. Mama
propiamente preparara las comidas, incluso si esto es dentro de un juego.
Maa-kun debe también propiamente comer su desayuno, comida y cena.”
Arreglo sano para comidas. Esa es la
verdadera esencia de una madre ama de casa.
Mamako insistió en eso.
“A pesar de eso, sería bueno si hubiera
un lugar que pudiera dejar a mama usar la cocina…”
“Esa es una solicitud difícil… pero
déjamelo a mí. Como un héroe, mostrare mi liderazgo aquí y guiarles a la mejor
“¡Um, por favor escúchenme! ¡Hay una
posada que coincide con el deseo de Mama-san! ¡Lo se, porque he estado en este
pueblo por el tiempo completo! ¡Les guiare a todos a la posada que provee la
cena y deja usar la cocina en la mañana!”
“¡Eso sería de gran ayuda! ¡Porta-chan
es en verdad confiable!”
“En la otra mano… este héroe de aquí no
hizo nada. Puu, que risa.”
“¡Kuh! ¡Pero no me rendiré! ¡La proxima
vez, la próxima vez será mío!”
¡Brillare brillantemente justo como la
primera estrella!… Masato miro al cielo del anochecer con un rostro lleno de
En ese momento, Porta mostro una
expresión nublada.
“Ah, pero… la posada que presentare solo
tiene habitaciones dobles, creo que sería un poco difícil a decidir cómo
compartir las habitaciones…”
Compartir habitación. Quien se quedaría
con quien en una habitación… quién podría quedar con quien en la misma
habitación por la noche.
Con el repentino problema, el único
hombre en un equipo con tres mujeres se detuvo en el punto.
“Sin una duda, Maa-kun va a compartir
habitación con mama, ¿correcto?”
“¿Hohou? ¿Pregúntame al morir?
Firmemente lo rechazo.”
“¡Entonces déjame quedarme en la misma
habitación con Mamako-san! ¡Actuare como una hija fiel y embarrarme a ella
tanto como sea posible! ¡Podría incluso usar magia de ilusión! ¡Kekeke!”
“Para con esa risa como mini-demonio.”
“Mama no le importa compartir la
habitación con Wise-chan… sin embargo, si eso fuera a pasar…”
Si Mamako y Wise comparten la
habitación, inevitablemente, el restante Masato y Porta tendrían que compartir
un cuarto.
“Mama está un poco preocupada… Maa-kun
también parece bastante interesado en Porta-chan… y Porta-chan es…”
“¡Daré lo mejor de mí misma para ser
útil para Masato-san! ¡Puedes decirme cualquier cosa! ¡Hare lo que sea!”
“Este tipo de sentimiento, así que… Mama
esta preocupada si hace una equivocación.”
“Qué estás diciendo, Mi Madre. Por
favor, confía en tu hijo caballeroso.”
“Por supuesto mama cree en ti. Porque
Maa-kun no tiene el coraje para atacar a una linda chica durmiendo indefensa al
lado de él.”
“No quiero ese tipo de confianza…”
“Pero eso es solo un tipo de escenario,
así que vamos a hacer esto en su lugar.”
Mamako camino cerca de Porta, entonces
la abrazo desde atrás.
“Porta-chan compartirá la habitación con
mama. Es una rara oportunidad, así que vamos a dormir en la misma cama. ¿Okay?”
“¡S-Sí! ¡Estoy agradecida! Ehehe.”
Mamako y Porta habían decidido compartir
la habitación.
“Eso significa…?”
“Eso significa…?”

Los restantes Masato y Wise, que se miraban uno al otro con ojos vacíos, deberían compartir habitación…

Okaa-san Capitulo 2 (Parte 3)

Capitulo 2 Es solo una coincidencia que sean solo chicas.
No me malinterpreten. No me miren con esa sonrisa.
“¡Ouuuuuuch! ¡Oi, qué estás haciendo tú
“¿Eh?… ¿¡Qu!?”
El documento que estaba pisando
repentinamente exploto, mandando a volar a Masato y como fue empujado, el
noqueo su cabeza contra la mesa. “¿¡Hagh!?” En serio doloroso. Fue lo
suficiente doloroso para hacerlo perder su memoria entera desde la infancia,
pero más que eso.
Había una silueta en la pantalla de humo
causada por la explosión. Esa forma temblorosa fue cerrándose paso a paso con
fuerza que parecía perforar a través del piso.
La figura mostró a una chica con
chaqueta carmesí que tenía un patrón geométrico estampado en este.
Largos y afilados ojos con un rostro
furioso, y una mejilla con una huella de pisada.

“¡No te hagas el tonto alrededor de mi!
¡He estado actuando muy madura hasta ahora! ¿¡Si no paras con eso, en verdad
hare Chainspell con magia de muerte instantánea!? Una docena de hechizos
vendrán a ti, ¿¡sabes!?”
“Una docena significa doce veces huh.”
“¡Sería un Chainspell, así que el doble
serán veinticuatro veces! Más bien, ¿¡porque estás hablando tan calmadamente!?
¡Ah, lo que sea, tan irritante!… ¡Propiamente te regresare el favor por
deberme! ¡Dame un momento!”
La chica con una pisada en su rostro
sacudió su mano y un grueso libro como diccionario apareció, ella hojeo las
paginas y canto.
“Supra・La・Magia・Peru・Mirare… ¡Teletransporte(Transporte)!”
Fue un instante de brillantes y
sensación de flotar.
“… ¿¡Ouch!?”
Masato aterrizo con su trasero encima de
Fue un pastizal con hierba corta
creciendo salvajemente. Una larga alfombra verde extendida, mientras el Pueblo Kassan
podría ser visto más delante.
“¿Hah?… Podría esto posiblemente…
quieres decir que he sido transferido a un diferente lugar instantáneamente…?”
“Es como eso.”
Una voz vino desde encima de su cabeza.
Mirando arriba, una sola persona estaba bajando. De una manera que pisaría en
su rostro.
Él podría evadirlo si quería, pero
Masato no lo evadio.
que era este tipo de persona al momento que la vi a ella… mis ojos estaban en
lo correcto después de todo…
Esto era, en otras palabras, venganza.
Ella uso magia para transformarse en un
documento. Mirando atrás en la situación, ella probablemente había
intencionalmente hecho una aparición destellante, entonces pidiendo si podría
volverse una compañera o no. Sin embargo, Masato solo le descarto, además, piso
sobre ella, provocando eso “¡No te hagas el tonto conmigo!”.
Entonces no podría evitarse. Él le
dejaría hacerlo hasta que estuviera satisfecha.
Ella solo apunto a pisar el rostro de
Masato, ligeramente incrementado la presión, empujando la cabeza de Masato
contra el piso de hierba… Él pensó que podría estar sonriendo ella por esto,
pero parece que no era ese tipo de persona.
La chica que aterrizo encima del rostro
de Masato ligeramente cerro sus ojos, y tomo un profundo suspiro.
“Fuu… el viento se siente placentero…
déjame decirte una cosa buena.”
“… ¿Qué podría ser?”
“Este lugar es mi lugar favorito.”
“Quien sabe. No me importa sobre ese
tipo de cosas… Más bien, estas satisfecha ya, ¿cierto? ¿Puedes dejarme ir con
esto ya?”
“Eso es cierto. Bueno, bien. Ya que
estoy satisfecha, te dejare ir.”
El pie que estaba pisando en su pie
floto y aterrizo en la hierba.
Masato se sacudió del asunto en el acto,
y justo como pensó, la chica que estaba satisfecha después de vengarse estaba
ahí. Ella cruzo sus brazos con una actitud de jefazo, sintiéndose la gran cosa
mirando hacia abajo contra Masato sentado. Ella era el tipo takabisha[1]
después de todo.
A pesar de su rostro, bueno, podría
probablemente ser agrupada en la categoría de linda…
cerebro es una falla a pesar de ser un Filósofo, parece que estoy en lo
El viento fluyendo paso en el pasto
haciendo su falda zarandearse, él no dijo nada y pudo fisgonear bajo la falda
sacudiéndose, pero la persona en sí era totalmente inadvertida de esto. Masato
pretendió no ver nada por el momento. También no había punto en hacerlo.
La chica mostro un rostro victorioso y
un glorioso refunfuño con su nariz, ella estaba claramente de buen humor.
“Fuun. Aceptaste el pisarte de una
manera adulta. Puedo elogiarte por esa actitud resuelta.”
“Gracias… ¿Así qué? ¿Qué es lo que
pretendes después de traerme aquí?”
“Estoy pensando sobre eso ahora. En
serio pienso sobre lo que hacer aquí ahora.”
“Qué con eso…”
“Cállate. Es tu culpa… No solo te
teletransporte aquí sin pensar en nada. Como iba a hacer que me la pagaras,
pensé que definitivamente te resistirías, así que te traje a un lugar que
podría no tener problema alrededor y usar magia para volar y pisar sobre tu
cuerpo medio muerto.”
“Eres en verdad singular.”
“A pesar de eso, actuaste como un adulto
y me dejaste pisarte. Gracias a tí, mis planes fueron todos arruinados. Geez…
bueno está bien… entonces lo tomare todo para ir de acuerdo al plan.”
La chica Filósofo ligeramente cerró sus
ojos, disfrutando la confortable brisa.
“Fuu… el viento se siente placentero…
este lugar es mi lugar favorito.”
“Como he dicho, no lo sé. En serio no me
importa sobre eso.”
“No preocuparse no es bueno, ¿no es así?
¡Solo piénsalo por un poco!… Dos personas conociéndose en mi lugar favorito.
Una gentil atmosfera… ¡Este es el tipo de situación donde una plática
importante pasara!”
“No solo vayas y hagas una situación u
otra para comenzar con esto. Si tienes algo que decir, entonces solo dilo
rápido. Hazlo rápido digo, rápido… Básicamente quieres volverte nuestra
compañera. Esta es la razón de porque hiciste esto. ¿Estoy en lo correcto?”
“Guh… B-bueno, simplemente hablando, ese
es el caso…”
“Entonces dilo rápidamente. Te escuchare
propiamente. Hey, siéntate primero.”
Masato golpeo el suelo y le urgió a la
chica. Ella estaba en un mal humor, pero aun así bajo su cintura. Ella estaba
justo al lado de Masato. “…¿N-no estás un poco cercas?” “¡Tú fuiste el que me
dijo que me sentara aquí!” Ellos se ajustaron a una distancia adecuada.
Mientras miraban el pueblo distante,
ella comenzó la conversación ligeramente emocionada.
“Mi perfil ya estaba escrito en el
documento, pero al menos hare una auto-introducción… Soy Wise. Mi profesión es
Filósofo. El grimorio con incremento de poder pasivo que recibi como  Privilegio por Primera vez es mi equipamiento
estándar. Ataque, recuperación o apoyo, déjame todos siempre y cuando sea sobre
magia. Gusto en concerté.”
“Gracias por la cortesía. Soy Masato.
Profesión es un guerrero… bueno uh, más o menos soy un héroe. Soy un espadachín
anti-aéreo. Gusto en conocerte.”
“Puff, un héroe, que gracioso.”
“¡Ellos decidieron eso! ¡Déjame solo!…
Entonces, justo como mencione, soy un jugador de prueba, pero ya que recibiste
el Privilegio de Primera vez, ¿asumo que eres uno?”
“Es como eso. Soy un JK jugador de
prueba de 15 años de edad. Ah, eso es cierto. ¿Quieres ver mi tarjeta de
número? Puedo probar que soy una Japonesa inmediatamente.”
“Suficiente con la información
“Ok, me detendré.”
Con tal sentimiento sobre acogedor, el
saludo fue hecho.
“De regreso al tema… tú, ¿Cómo cuanto
sabes sobre la situación actual?”
“Situación dices, ¿quieres decir sobre
yo estando aquí ahora? Por el momento, sé que he sido puesto dentro de un
juego, pero… de porque mi mama ha venido también, aún tengo algunas dudas…
Rey-sama y mama no me dijeron.”
“Entonces déjame contarte.”
Wise ligeramente exhala, y le dice en un
tono serio.
“Porque nuestras madres nos acompañan…
es debido a que este juego es MMMMMORPG, o más bien… en otras palabras, ¡[Mama no, Mama ni yoru, Mama no
tame no, Mama to Musko moshikuwa Musume ga, Oini nakayoku
naru tame no, RPG] es la razón!”
[Mamas, con Mama, por el bien de Mama,
Mama e hijo/hija, para llevarse mejor, RPG.]
Exactamente. Esa fue la verdadera
naturaleza del juego al que Masato fue transportado. ¡La verdadera impresión
vino a salir a la luz!
Sin embargo, era imposible para Masato
mostrar una reacción impresionada.
“No, ¿qué estás diciendo? ¿Estás
haciéndote la tonta?”
“¡No me hago la tonta! ¡Quienes hacen el
tonto son aquellos que pensaron en esto! ¡Estoy diciéndote la verdad, así que
solo escúchame! O te juro que hare Chainspell con magia de muerte instantánea y
magia de resurrección en ti, ¿¡sabes!? Voy a matarte, revivirte, entonces
repetirlo siempre y cuando tenga magia, ¿¡escuchaste!?”
“Si al final voy a ser revivido,
entonces creo que está bien, pero… Entiendo, propiamente te escuchare, así que
continua tu historia.”
Wise se recompuso, y continúo hablando
con un rostro simple.
“Este juego fue hecho por el bien de
padres e hijos teniendo aventuras juntos y volverse más íntimos. Teniendo a
padres e hijos transportados juntos como un grupo, y entonces dirigiéndose a
aventuras juntos… No sé exactamente como fue hecho este juego y los detalles al
respecto, pero… he confirmado una cosa.”
“Tú no puedes volver al mundo original
si no satisfaces la condición para completar este juego.”
“Oi oi, ¿es en serio? Nunca escuche
sobre esta regla… Entonces, ¿Cuál es la condición?”
¿Esa condición era?
“Para padres e hijos volverse mucho más
Wise hablo sin dejar salir un suspiro. No bromees conmigo.
Masato entendió bien el sentimiento.
“¡Oi oi oi oi! ¡Que diablos es esa
condición! ¡No tiene sentido! ¡Aquel que pensó de esto como buena idea tiene un
tornillo suelto! ¡Puede posiblemente ser ese tipo de juego!”
“¡Santo cielo! ¡Yo también, cuando fui
repentinamente traída aquí y mama me dijo sobre esto, fui tan impactada que
quede en ojos blancos! ¡Incluso deje de respirar!”
“No, dejar de respirar no es bueno.
Cuídate a ti misma más, JK.”
“Llore lo suficiente luego, así que
estoy bien.”
Si la actual JK dice así, bueno,
entonces es cierto.
“Pero que extenso deberíamos nosotros
volvernos más íntimos antes de completar esto, no es claro… pero, bueno,
probablemente sea una tarea fácil para algunos mothercon que va de aventura con
su madre.”
[Kiel: La misma fregada de
brocon/siscon, pero con la madre…]
“No tengo idea de que estás hablando.”
“Sin embargo, una madre con una mala relación
con su niño es lo peor. Es absolutamente imposible completar. Un millón por
cierto imposible.”
“Por ejemplo… ¿alguna cierta Filosofo?”
El hablo basado en los hechos, y Wise
solo bajo sus hombros. Ella dejo salir un suspiro en el viento en una manera
“Yo también salí de viaje con mi mama al
principio. Durante el camino, tuvimos una gran riña, entonces eso fue todo de
mí. Mi mama es la peor… más importante, en primer lugar, jugar un juego con tus
padres solo es imposible, ¿cierto? No es imposible no importa cuanto lo piense
sobre eso, ¿cierto?”
“Eso es, bueno… yo también, ‘En serio,
no me incluyan en eso’ es lo que pensé…”
“Gracias a eso, se volvió imposible para
mi completarlo. Me quede atrapada en este mundo como una princesa encerrada.
Fufun, princesa.”
“No importa cómo te mire, puedo
claramente decir que no eres una princesa, así que no digas eso.”
“Es solo una forma de decirlo. Este tipo
en verdad me molesta.”
“Así que porque quieres volverte mi
compañera… aah, podría ser… quieres subirte en esto para regresar al mundo
original cuando yo y mi mama lo completemos, ¿algo como eso?”
Él pregunto basado en una hipostasis,
Wise malignamente carcajeo. Esta persona es una persona malvada.
“Dilo, tu madre parece como una persona
en verdad gentil y buena, ¿no es así? Además, estoy pensando en volverme la
hija de tu madre, entonces completar esto y regresar. Ese es mi plan de
“Volverte la hija de mama… en otras
palabras, una hijastra… eh, oi, espera. Eso quiere decir…?”
Wise y Masato podrían casarse, ¿entonces
ella podría ser llamada por Mamako ‘Madre por ley(Mama)’?
Eso podría pasar, ¿cierto?
Los dos se miraron uno al otro antes de,
“¿¡Espera!?” Wise manifestó el grueso grimorio y cacheteo la mejilla de Masato.
“¿¡Quítale la propiedad de daño!?” Era un ataque físico de una profesión
mágica, y aun así, fue en verdad doloroso. Fue una gran cantidad de daño.
“¡N-no pienses en cosas estúpidas! No
hare algo como eso, está el método de adopción, ¿correcto? ¡Incluso así, tú y
yo siendo parientes! ¡Eso es todo!”
“O-Ohh, eso es cierto. Esta la adopción…
También rechazo tener una esposa maga con fuerte poder de golpe…”
“¡También no quiero volverme la esposa
de un tipo mothercon! ¡Hmph!”
“No soy un mothercon, creo. No
Era un importante asunto, así que
propiamente enfatizo.
“Fumu… en cualquier caso, entiendo tus
circunstancias y el plan de batalla.”
“Entonces deja de malgastar el tiempo y
hazme tu compañera ya. Dare todo de mi para llevarme mejor con tu mama. Actuare
como una chica super linda que cualquiera podría querer tenerla como hija.
“Diciendo tales vergüenzas tan
[Kiel: Con la frase de Wise, me imagine
a Arisa de Death March…. |lol)/]]
Ya se mira como una bandera fallida en
este punto. Él no podía evitar sino sentir una premonición del plan fallido de
Masato tenía otro pensamiento en su
“…Hey, ¿puedo decir solo una cosa?”
“Si es solo una cosa, entonces puedo
escucharte. Hazlo corto.”
“Entonces seré conciso… ¿No puedes solo
reconciliarte con tu mama?”
Fue una muy simple cosa.
Wise se separó de su madre debido a una
riña. Ella podría no regresar al mundo original. Entonces los dos podrían estar
bien si solo se reconcilian. Cualquiera diría que la primera cosa podría estar
bien. Solo diciendo “Lo siento” podría ser suficiente. Él creía que podrían
manejarlo de alguna manera.
Exhalando un profundo respiro mezclado
con enojo, Wise hablo infeliz.
“Eso es irrazonable. Es obviamente
irrazonable. Es imposible para mí y mama a reconciliarnos… No metas tu nariz en
los asuntos de otra familia. Eso es molesto para mí.”
Después de decir eso, Masato podría solo
retirarse. Profundizar más sería tabú.
“Así que, ¿Qué será? ¿Me dejaras ir como
tu acompañante? Lo deseas, ¿cierto? No dirás algo como “No sé lo que mi madre
podría decir~”, ¿cierto?
Uwah, disgustante.”
“Nunca he dicho eso.”
“Entonces arregla tu mente ya. Hey,
“Vamos a ver…”
Honestamente hablando, Masato no podía
esta de acuerdo con el plan de Wise.
En la otra mano, si consideraba desde el
punto para hacer un equipo, ¿entonces como podría tornarse a ser? Él confirmo
que Wise podría usar magia como un Filósofo. Ataque, apoyo, recuperación,
podría esperar un amplio rango de actividades de ella. Si pudiera perdonar todo
y resistir su personalidad y naturaleza humana, ella podría ser bienvenida como
compañera con los brazos abiertos.
Él también sintió que si va a jugar un
juego con alguien, entonces tener a alguien de la misma edad en el grupo podría
ser mejor que nada.
Al final, tener información detallada
respecto a este mundo era un punto fuera para Masato.
Los asuntos padre-hijo de otra gente
eran sus propios asuntos. No podría ignorar su habito de interrumpir a otros,
entonces la  respuesta era ya clara.
“Haa… no se puede evitar. ¿Supongo que
tenerte con nosotros estará bien por ahora?”
“Eso significa que estás diciendo
‘absolutamente quiero esta linda Filosofo-sama como mi compañera’, ¿cierto?
Fufun. Tienes unos lindos buenos ojos. Muy bien, me volveré tu compañera, así
que muestra tu gratitud.”
“¿Qué con ese remarque?”
“Originalmente, se supone que me
mostraría con estilo mientras estuviera en medio de elección de compañeros y
dices eso, pero supongo que está bien. Ya que conseguí decir esto aquí, estoy
“Dirigiéndote a la dirección sin razón
‘de acuerdo al plan’… bueno, esta bien. Así que entonces, aquí.”
Masato elevo su mano. Él estaba pidiendo
por una sacudida de mano como una señal de volverse compañeros.
Wise miro a esa mano, entonces
lentamente estiro su mano como si ella estuviera avergonzada… las manos de Wise
y Masato se tocaron… Justo antes de tocarse.
El suelo rugió violentamente.
Vamos a regresar varios minutos atrás
antes de esa charla.
En el segundo piso del Gremio Aventurero,
en la habitación donde Masato repentinamente desapareció. Varios Magos
aparecieron desde un Circulo Mágico, y buscaron el piso y las paredes a
profundidad. Sin embargo, no pudieron encontrar lo que estaban buscando.
Shirarase, que estaba comandando a los Magos a investigar, volteo alrededor e
impacto su cabeza con malestar.
Ellos estaban intentando encontrar que
había pasado, pero resultó ser un malgasto de tiempo.
Shirarase suspiro con resultado
predicamento, entonces le dijo a Mamako.
“… Lo siento. Por el bien de protección
de privacidad, no hemos implementado un sistema que pueda rastrear actividades
de jugadores de prueba y localización en todo momento… somos incapaces de
determinar la ubicación de sus hijos.”
“Es eso así… entiendo. Me disculpo por
molestarlos. Gracias por toda la ayuda.”
Los magos se fueron con rostros amargos.
Después de enviarlos fuera, Mamako dejo salir un suspiro pesado, y se puso de
pie en el punto donde su hijo estaba justo hace un momento.
Al lado de Mamako de pie, Porta
tímidamente camino de cercas. Ella no sabía que decir, pero incluso así, al
menos si pudiera animarla… Como Porta miro a ella con su desesperación, con
rostro en coraje, Mamako me abrazo.
“Está bien. Maa-kun está bien.”
“¡Si! ¡También lo creo así! ¡Ya que
Masato es un héroe!”
“Si, eso es cierto. A diferencia de mí,
aunque su ataque normal es un solo ataque de un solo objetivo, él
definitivamente esta bien.”
“D-diciendo eso lo haces sonar como una
persona ordinaria supongo… ¡pero Masato-san es de quien hablamos!”
Mamako declaro así claramente, pero su
expresión no era brillante.
“Sin embargo… como podría ponerlo, no
puedo explicarlo bien, pero… Algo malo está a punto de pasar, que es lo que
“Algo malo… ¿¡n-no me diga, Masato-san
será atacado por monstruos!?”
“Hmm, es un poco diferente que eso,
supongo. No como eso, pero más como esto… más bien, siento que algo está mal
para mi pasara.”
“¿Para Mama-san, es esto?”
“Qué exactamente es, me pregunto… Algo
malo para mi… Aah, eso es.”
Mamamo repentinamente pensó en algo.
“Qué si… Maa-kun deja a mama sola y se
vuelve más íntimo con alguien aparte, entonces eso podría ser algo en verdad
malo para mí.”
“¿Eh? ¿E-es eso así?”
“Maa-kun está ahora teniendo una
aventura para volverse más íntimo con mama. A pesar de eso, si se vuelve más
íntimo con alguien más, dejara el lado de mama y viajara con esa persona,
entonces mama estaba muy sola. Definitivamente llorare.”
“Erm… C-creo que Mama-san llorando no es
“No puedo dejarlo como esto. ¡Debemos
encontrar a Maa-kun rapidamente!”
Sin embargo, ¿ella tenía alguna manera
para hacer eso? ¿Cómo iba a encontrar a Maa-kun?
En ese momento, Shirarase murmuro
mientras pensaba.
“… La posibilidad es baja, pero hay tal
vez un metodo.”
“¿¡Es eso verdad!? Por favor dime cómo
hacerlo… ¿¡no, por favor infoformame!?”
“¡Por supuesto! *Destello*”
Escuchando las palabras de Mamako, los
ojos de Shirarase cambiaron de color. Ya que uno hablaba de infoformar, podría
ser ella.
“Escucha bien, Mamako-san… el factor
decisivo de este juego es el lazo entre padre e hijo. Primero necesitas creer.
Fortalece el lazo entre Masato-kun y Mamako-san.”
“Siguiendo eso, Porta-san. Por favor
entrégale la Espada Sagrada de la Madre Tierra Terra di Malote a Mamako-san.”
“¡S-sí! ¡Aquí!”
Porta abrió su bolsa de hombro, tomo
fuera la espada color flama del equipaje de Mamako que ella mantuvo dentro, y
lo ofreció a Mamako.
“Ahora, Mamako-san. Eleva tu espada, y
llama a la tierra… Madre Tierra es una madre también. Notando los sentimientos
de Mamako, debería responder a su deseo.”
“¿¡En verdad!?”
“Si… ¡Probablemente! *Mirada de lado*”
“¡Lo entiendo! ¡Incluso si es una
oportunidad, yo creeré!”
Mamako elevo la espada con su mano rezo.
“O gran Madre Tierra… si eres también
una madre, tal vez entiendes mis sentimientos… No tengo intención de interferir
en la relación de mi hijo y sus amigos… eso es también un asunto importante,
pero solo quiero decirle que quiero volverme más íntimo con él… ¡Si entiendes
este sentimiento, por favor dime la localización de Maa-kun!”
Mamako dio un tajo de su espada junto
con su deseo.
Entonces, en una parte de un pastizal a
las afueras del pueblo, más allá en la dirección de la ventana, la tierra
tembló, *!Zugo¡* anormalmente, se elevó y disparo hacia el cielo. Una torre de
tierra fue hecha en un instante.
En ambos lados de estas dos figuras
fueron arrojadas en el aire. Ellos parecen haber sido apartados forzosamente.
“¿¡Aahn!? ¡Ese es Maa-san! ¡El que está
siendo enviado a volar con una increíble rotación es Masato-san! ¡Tengo la
habilidad apreciación, así que mis ojos definitivamente no se equivocan!”
“Bueno bueno, él está en tal lugar…
Ufufu, qué es esto, me pregunto. Siento que tengo que ganar una batalla muy
importante justo ahora.”
Mamako se siente como ella había
derrotado a un enemigo(?).
Encontrando la localización de su hijo
perdido, además, interrumpiendo una escena de un solo lado, ella había
aprendido la habilidad de apoyo【Colmillo de Madre】.
“¡Por favor infórmame inmediatamente si
algo pasa! ¡Entonces, por favor discúlpame!”
El guardia saludo diligentemente,
entonces camino mientras su armadura de metal hizo sonidos *clang clang*.
Mamako volteo a la chica de nuevo,
después de enviar partir con un golpe ligero.
“Tú deberías ser… La Filosofo Wise-chan,
“Si, mama. Soy la Filosofo Wise.”
Wise se apoyó en sus rodillas y bajo su
cabeza cortésmente en el punto.
“He seguido la profecía recibida por el
rey de los espíritus, que sabe todo en el mundo, y vine para ser invitada por
el héroe para acompañarle en su viaje. Por favor, permítame ser la compañera de
todas, no, incluso mejor, como hija de madre. Déjeme estar a su lado.”
“Bueno, bueno, gracias por la cortesía…
¿Pero sabes, Wise-chan?”
“¿Qué puede ser, madre?”
“No tienes que forzarte a ti misma para
ser cortés. Ya te he escuchado rugir ‘¡No hagas el tonto conmigo!’. Puedes solo
hablar como siempre, ¿sabes?”
“N-no, eso es un malentendido, madre. Ya
que tengo la profesión Filosofo, la gente tiene la impresión de que soy inflexible,
he usado tales palabras rudas por el motivo de evitar eso…”
“¿Oh es eso así? Filosofo-san también
tiene un montón de problemas.”
“Es exactamente como dice… Como tal,
madre. Por favor permita a esta cortes, bien portada, de cabeza clara, linda Filosofo
acompañarla como hija de madre.”
“Hmm, siento como hacer eso, pero… Tal
vez sea un poco difícil…”
“¿P-Porque es eso!?”
“Porque Wise-chan ha sido arrestada.”
Wise estaba al otro lado de las barras
de hierro. “Cierto. Ahaha… *Snifh*… ¡Uwaaaaaaaaaaaan!”
Wise lloro.
Wise estaba en detención después de haber sido arrestada.

[1] Takabashi – Una categoría de personalidad moe. Pienso que es como Tsundere, pero nunca va a ir completamente dere hasta el final. Ejemplos: Kashiwazaki Sena (Tomodachi), Kousaka Kirino (Oreimo), Kunitachi Rinka(Ni recuerdo).

Okaa-san Capitulo 2 (Parte 2)

Capitulo 2 Es solo una Coincidencia que sean solo chicas.
No me malinterpreten. No me miren con esa sonrisa.
Ellos reajustaron el interior por el
bien de la entrevista. Entrevistador Mamako y comentarista Masato sentados lado
a lado y preparando las sillas del lado opuesto de la mesa para entrevistas.
Entonces finalmente comenzaron.
“Ya que esta es una entrevista con mama,
mama es la que hará las preguntas. Deja esto a mama.”
“Y-ya lo sé. Entonces confiare en tu
estricta inspección… Entrevistado uno, entre.”
La que entro a la habitación fue la
compañera candidato uno, con su rostro y voz claramente tenue, la Caballería
Pesada Rushiela.
“¡Gusto en conocerle!”
“Mucho gusto. Entonces sin decir más,
¿tienes algún pasatiempo?”
“¡Mi pasatiempo es tomar el ataque
favorito del enemigo y regresarle el doble de dolor!”
“Pareces tener un pasatiempo mentalmente
retorcido… Así que, ¿A dónde te gusta salir más seguido?”
“¡Salgo a los campos con singulares
monstruos basura que son más débiles que yo!”
“Pareces ser una intimidadora abierta…
Entonces al final, me pregunto si escuchamos tu plan de vida. Cosas como lo que
quieres hacer en el futuro. ¿Has considerado alguna cosa como eso?”
“¡He considerado aprender la habilidad
que puede reflejar el ataque de regreso para causar daño, haciendo al enemigo
“Puedo solo describirte como un ser
malévolo… Entiendo. Entonces, mi juicio es…”
Haciendo una sonrisa, Mamako…
Mostro una señal X. Falla.
“Discúlpame por ser grosera, pero me
pregunto lo que esta persona piensa sobre los seres humanos.”
“¿¡Ella solo dijo cosas que son normales
para un rol de defensor!?”
Incluso si ese fue el caso, ella fue
sacada en la entrevista de mama. Lamentable. Entonces, moviéndose al siguiente.
Compañero candidato dos, con una sonrisa
cálida que podría sanar la fatiga mental, la hermosa elfo Sacerdotisa Sarite.
“Gusto en conocerte. Así que, ¿puedo
escuchar cual es el pasatiempo de Sarite-san? Me pregunto qué haces
“Usualmente ofrezco mis oraciones a
nuestro Dios en días normales. Trecientas veces al día.”
“Con seis horas al día para dormir,
incluso rezas una vez cada cuatro minutos no es suficiente… Entonces, ¿A dónde
te gusta salir seguido?”
“Usualmente voy a las iglesias localizadas
en varios bosques, y ofrezco mis oraciones. Veinte lugares cada día.”
“Sabio tiempo, es entendible que lo
gastes mayormente en iglesias… Entonces, ¿Cuál es tu sueño para el futuro?”
“Deseo que cada persona siga la voluntad
de nuestro Dios y ofrezca sus oraciones.”
“Puedes continuar rezando a donde
quieras que vayas. Gracias por tu arduo trabajo, puedo solo decir eso a ti.”
¿Cuál fue el juicio de Mamako, que
mostro una sonrisa de cortesía?
Fue la señal X. Fallo. Descalificada.
“¿¡Hey, mama!? ¿¡Porque ella esta
descalificada!? Ella es una elfo y una Sacerdotisa como eso…!”
“Ese es el problema. No tengo intención
de negar su libertad de religión, pero… Después de volvernos compañeros, si
recibo ‘Ese es un buen lugar cercano, ¿así que quieren venir por aquí?’ tal
invitación, sería eso un poco… Mama no es buena a rechazar este tipo de cosas,
ya vez.”
“Uu… Lle-llegando a ese punto, tengo que
aceptarlo un poco…”
Podría ser un poco difícil para una
persona no-religiosa estar en contacto con ella, lamentablemente.
Compañera candidato tres, con una voz y
un cuerpo en un espíritu joven, la sucia ladrona Torino.
“¡Chii-ssu! ¡Un gusto!”
“Así que tus pasatiempos…”
“¡Mi pasatiempo es probablemente
[Despojar]! ¡Un golpe, un robo! ¡Es muy divertido!”
“Lugares a los que sales…”
“¡El mercado negro! ¡Las comisiones son
costosas, pero puedo comprar casi lo que sea!”
“Planes a futuro…”
“¡Probablemente quiero robar algo como
del tesoro del castillo real! ¿¡Es un sueño de ladrones, cierto!? ¡Kyahaha!”
“Ya veo, entiendo, descalificada.”
Mamako que pronto se convenció,
inmediatamente revelo una señal X.
“Bien entonces, vamos a ir a la policía
juntos ¿bien?” *Agarrar*
“¿¡Ueeeeeeeh!? ¿¡Mis caderas están de
alguna forma atoradas!? ¿¡Qué con esta misteriosa fuerza!?”
Mamako estaba acompañando a Torino
después de capturarla. La fuerza de una madre que no puede perdonar a niños
malos, fue tremenda.
“¡Hey, mama! ¡Calmate! ¡Ser ladrón no es
un problema! Aunque pienses que son ladrones. ¡Es un trabajo normal en juegos!
¡Esto es un juego después de todo!”[1]
“Incluso en un juego, hay chicos buenos
y chicos malos, ¿cierto? Mama siente que no será bueno si no hago esto
“¡Eso es verdad, pero eso no es así!
¡Escúchame primero!”
Después de eso, tomo alrededor de treinta
minutos convencer a Mamako.
Con eso.
“Kuh, algo como todos siendo
“Una profesión que dara una mejor paz
mental es mejor. Por ejemplo… ¡Ah, es cierto! Personas como oficiales de
policía, fuerza de auto defensa, ¿¡qué hay sobre elegir un compañero como
“¡No hay tal profesión en un RPG de
fantasía! ¡Te lo imploro, por favor entiende que esto es un juego!… ¡Ah, lo
que sea! ¡Entonces tomare otros miembros, por favor espera por un momento!”
Adoptando el criterio de Mamako, era duramente
que alguna persona como esas podría volverse compañero, pero… incluso así,
Masato desesperadamente trabajo en la selección de candidatos.
Él paso a través de los documentos
adicionales de Shirarase… Y.
“… ¿Nn? Este es…”
Masato repentinamente detuvo su mano.
Leyó a través del documento en su mano cuidadosamente.
El nombre registrado de aventurero fue
[Wise (Sabio)]. Femenino, quince años. Su profesión era de hecho Filósofo. Era
una profesión avanzada que podía libremente usar tanto, magia negra, que era el
término general para magia de ataque, y magia blanca, que era el término
general para magia de recuperación y apoyo.
Una chaqueta corta con falda, la chica
vestía en traje carmesí haciendo su rostro brillar con confianza.
Aunque fuera solo un retrato.
“Ella parece ser bastante buena en
términos de habilidad… ataque con magia, además recuperación y apoyo, parece
ser capaz de contribuir en todos los aspectos.”
“Ah bien, eso parece increíble. Ella es
una chica muy excelente, ¿no es eso bueno?”
Mamako fisgoneo sobre el lado, ella
parece estar interesada con la mirada.
“Err… con respecto a mama, ¿una
profesión que usa magia está en la zona segura?”
“Por supuesto está bien. Mama ha siempre
querido volverse una maga desde joven. En ese entonces, estaba en un cierto
anime de chicas mágicas que fue un gran éxito. Mama también veía eso en
“Ya veo ya veo. Eso será de ayuda.
Entonces ya que usuarios de magia esta OK… Es lo que quisiera decir, pero…
Los ojos de Masato no pudieron ignorar
un punto.
“Ella tiene algo escrito que remarcar en
la columna… 『¡Usare
Chainspell[2] con magia de muerte instantánea si no me toman!』está escrito
aquí. Uwa, ella tiene zafados algunos tornillos de la cabeza.”
“No es bueno decir ese tipo de cosas.
¿No es Filosofo-san genial? Para ser capaz de usar dos tipos de magia. Su
rostro también parece linda, creo que ella es una chica asombrosa.”
“¿Haa?… Ahh, es verdad que ella tiene
un rostro de aspecto propio, pero no puedo decir que ella es linda.”
“¿No es de la preferencia de Maa-kun?”
“No es sobre eso… sus ojos. No puedo
soportar aquellos ojos.”
Los ojos de la chica en el retrato,
aquellos largos y afilados ojos… él estaba consiente sobre aquellos ojos que
parecen mirar justo a él.
“Sus ojos no son buenos. Ella definitivamente
tiene una personalidad intensa. Ella es el tipo que mira abajo a los otros,
actuando como jefe.”
“Nn, ella parece ser agresiva, y difícil
para lidiar con eso, pero… Me pregunto si ella tal vez se vuelva una buena
chica después de conocerla a ella.”
“No, no. Solo déjala sola, será mejor
así. Esta chica tal vez tenga un cerebro no tan diferente de aquellos
lamentables seguidores a pesar de ser un Filósofo. Disparando magia sin
considerar volar incluso a sus compañeros, edificios y terreno lejos con una
carcajada, también conocido como el tipo [Doramata[3]]. Mi instinto
de Héroe me dice así.”
“Hmm… Si Maa-kun dice así, supongo que
es verdad…”
“Exactamente. Entonces, está esta fuera.
Muy bien, adiós. Gracias por el trabajo duro, Wise.”
Él aplasta el documento de Wise en una
bola, y *poi* lo arroja.
(TLN: ¡Yuudachi! ¿Dónde está tu poi?)
El documento aplastado cae al suelo, y
él parece escuchar algo como “¿¡Tú!?” en ese golpe, o siente algo como eso,
pero fue probablemente solo su imaginación. Eso podría ser imposible. No hay
“Ahora bien, con eso fuera de la lista,
la siguiente es… oh, la largamente esperada profesión de producción
Compañero candidato cuatro. Su nombre
era [Porta]. Doce años. Su profesión era Mercante Viajero (Buhonero). De paso
un productor de objetos, ella tenía habilidades de apoyo de mucha ayuda tales
como apreciación y descuento.
Su retrato mostraba una linda y
esponjosa chica. Su rostro con pupilas redondas que parecen mirar detrás
estaban desbordando con inocencia de juventud.
“Fumu. Nada mal… Considerables
habilidades de apoyo, existencia como hermana menor… un buen potencial que
puedo nutrir con cariño.”
“Ah bueno, ella es una linda chica.
Entonces esta será la siguiente chica para la entrevista de mama.”
“Vas a hacer esto después de todo huh…”
Ante Masato y su madre estaba una chica
de doce años.
Su nombre era [Porta]. Su profesión era
Mercante Viajero.
Un mercante viajero era alguien que abre
tiendas para negociar, ellos viajan alrededor de varios lugares en el mundo,
están dentro de calabozos, bajo el agua, o en el cielo, dependiendo de la
situación del local. Son gente que podrían mostrarse dentro de cualquier lugar
y venden cosas para una vivienda. Su señal particular era una gran y abarrotada
bolsa de hombro (mochila).
Porta estaba abrazado esa mochila
tímidamente, y mirando hacia Masato y su madre con un rostro extremadamente

“G… ¡Gugugusto en cococonocerle!”
“Si, un gusto conocerte, también.”
“Está bien, calma. No tienes que estar
tan nerviosa.”
A pesar de decirle que no estuviera
nerviosa, ella no podía evitarlo. Porta, que estaba desesperadamente forzándose
a sus doce años de edad a mostrar una apariencia apropiada, era muy linda.
“Primero, por favor danos una breve
“¡Si! ¡Soy Porta! ¡Una jugadora de
“¡Ooh, jugador huh! ¡Rareza conseguida!”
“¡Bueno! ¡Porta-chan es también un
jugador de prueba!… Entonces, ¿Dónde está tu mama?”
“¿M-mi mama esta? Eso es, umm… err…”
Recibiendo la repentina pregunta de
Mamako, Porta mostro repentinamente una expresión problemática.
Sin embargo, ella elevo su rostro pronto
“¡Mi mama está tomando un descanso del
juego debido al trabajo! ¡Estoy viajando por mí misma, pero conseguí el permiso
de la gente de administración, así que está bien! ¡Totalmente no hay problema!”
“Ah, es así como es. Me pregunto si la
mama de Porta está muy ocupada.”
Porta de alguna forma parece estar muy
desesperada, así que fue ligeramente consternada, pero… Ya que la
administración lo había permitido, debería estar bien. Él no debería preguntar
sobre eso.
“Ok. Entonces hare la siguiente
pregunta. ¿Estas preparada?”
Masato miro a Porta con un rostro de
entrevistador estricto, y cuidadosamente pregunto.
“Primero, por favor explícanos como
Porta puede ser útil. Ya que eres un mercante, hacer negocios es tu
especialidad, ¿cierto?”
“¡Si!… Erm… ¡mi profesión es Mercante
Viajero! ¡Además, mis habilidades básicas están centradas cuando compro cosas y
me quedo en posadas!”
“¡Eso es asombroso! ¡Porta-chan es como
un cupón andante!”
“Mira aquí mama. Eso ciertamente es
verdad, pero por favor di algo diferente.”
“¡Y, esto es también una habilidad
básica de Mercante Viajero, uso almacén de equipo para manejar los objetos de
mis compañeros! ¡Puedo mantener un montón de objetos más de lo normal!”
“Puede decir, ¿podría ser que Porta-chan
carga todo eso? ¿Dónde?”
“Probablemente en esa bolsa. Puedo ver
que es un objeto mágico.”
“¡Si! ¡Recibí esto por el Privilegio de
Primera Vez, un increíble equipamiento solo para Mercante Viajero!”
Porta enseño la bolsa que ella estaba
abrazando para dejarlos verla.
“¡Esta bolsa puede almacenar trecientos
objetos! ¡El tamaño y peso de los objetos no le afecta! ¡Todo su equipaje puede
ser dejado a mi!”
“¡Bien, increíble! Tienes una
conveniente herramienta de almacenaje… Me siento mal por mi mismo que aun
refuta de una bolsa de compresión de futon.”
“Cada año antes del verano, mama trabaja
la gota gorda para empacar el futon…”
“Pero Maa-kun nunca ha ayudado a mi
incluso una sola vez.”
“N-no digas ese tipo de cosas…
Propiamente te ayudare desde ahora…”
Una bolsa de compresión de futon puede
escurrir el futon plano, así que podría tomar menos espacio para almacenar más,
fue en verdad conveniente. Pero dejando eso de lado.
“Ahora entiendo que ganancia tendremos
con un Mercante Viajero como compañero. Pero eso no es todo ahí, ¿cierto? Tienes
otras habilidades escribiste en los documentos, ¿no es así”
“¡Si! ¡He aprendido la habilidad de
apreciación! ¡Puedo saber el nombre y efecto de un objeto obtenido inmediatamente!
¡Puedo también decirles el precio! ¡Y entonces, y entonces, he recordado varias
habilidades de creación de objeto! ¡Puedo hacer los objetos necesarios por mí
“Eso es por lo que miraba más. ¿Está
bien asumir que objetos de recuperación y objetos de apoyo son sin sentido con
Porta alrededor?”
“¡Si! ¡Por favor déjeme eso a mi!”
Porta saluda respetuosamente, sus ojos
claros cristalinos brillan como mira directamente enfrente. Ella es una buena
chica. Muy buena. Él podría gustarle ser algo más que solo un acompañante con
Sin embargo.
“Fumu. He escuchado sobre los puntos a
favor de Porta, pero… déjame ver, no hay solo puntos buenos, ¿correcto? Debería
también ser aspectos negativos. ¿Estoy mal?”
Masato pregunto con un rostro de
entrevistador… Quiero ver ese lindo
rostro problemático de nuevo
, él podría no negar que estaba pensando sobre
eso un poco.
Sin embargo, Porta responde con sus ojos
puros sin pestañear.
“¡He sido registrada como un
no-combatiente! ¡Por eso, no puedo pelear!”
“Ya veo… entonces estas totalmente fuera
de la fuerza de combate. No tendremos un incremento en combatientes huh…”
“¡Pero, pero, por esa parte, manejare
sus equipajes y producción de objetos! ¡Intentare dar mi mejor con mi habilidad!
¡Pueden pedirme lo que sea! ¡Trabajare duro!”
Masato y Porta mantuvieron contacto
visual por un momento. Incluso así, los ojos de Porta no pestañearon.
Esta es una buena chica. Una buena chica
sin lugar a dudas. Ella claramente es una buena chica, sin mencionar que tiene
habilidades decentes. Encima de eso, ella es incluso un raro jugador de prueba.
Perfecto sin un solo aspecto era
exactamente sobre ella.
“Hey Maa-kun, es ya suficiente. Mama ha
ya decidido, ¿sabes?”
Mamako había ya elevado la señal O. *Pinpon
pinpon* Pasa.
“Si. No tengo objeción… Entonces…”
“¡Porta-chan, bienvenida a ser mi hija
en ley!”
“¡Si! ¡Soy bienvenida a ser su hija en
Porta se volvió su novia. Acha chico.
Loli novia en luna de miel.
“¡Alto ahí, pero eso no es!… ¡Oi, mama!
¡Estamos aquí buscando compañeros! ¡Sera mejor que pares de encontrarme una
novia o una esposa!”
“¡E-eso es verdad, lo siento!”
“Bien. Entonces una vez más… ¿Porta,
quieres volverte nuestra acompañante?”
“¡Si! ¡Daré lo mejor de mí! ¡Por favor
cuiden de mí!”
La Mercante Viajera Porta se volvió su
“Por favor cuida de mi desde ahora,
“¡Por favor cuide de mí también! Erm… ¡Héroe-sama!
¡Mama del héroe-sama!”
“Hey hey. Somos compañeros ya, así que
esa forma de decirnos no es buena. Está bien con llamarme [mama] o [], ¿sabes?
Puedes llamar a Maa-kun como [Maa-kun].”
“Sácame de eso. Llámame Masato
normalmente está bien. Por cierto, el nombre de mama es Mamako”
“Entonces, les llamare Masato-san y
Mama-san. Esta eso bien…?”
“Ok. Usar una manera más flexible de hablar
si es posible, pero probablemente se vuelva más familiar cuando vayamos de viaje
juntos. Vamos a hacer un montón de cosas de compañero desde ahora.”
“¡Si! ¡Trabajare duro!”
Ella apretó su pequeña mano e hizo una
pose de ‘trabajar duro’. Qué con esta cosa viviente tan linda. Esa lindura
provoco a Masato a acariciar la cabeza de Porta por impulso. “¡Hau! ¡Esta retorciéndose!”
“Mufufu. No está bien, no esta bien.” “Maa-kun…” “¿¡Hah!? ¿¡No me mires con
aquellos ojos tristes!?” Sus deseo exploto ante su madre que era un peligro
serio [Lolicon].
Bien ahora.
“¡Ahora, vamos a continuar incrementando
nuestros compañeros, justo como eso!”
“Es cierto. Mama también continuara con
su entrevista de mama.”
“Tú solo descalificas a ellas continuamente
si lo haces, cierto… uuu, ya estoy cansado… Supongo que tomare un descanso. Le pediré
a Shirarase-san para conseguir algo de beber…”
Como Masato se puso de pie de su asiento
y comenzó a caminar, un inesperado sonido *cruch* pudo ser escuchado. “¿Hmm?
¿Pise sobre algo?” Él miro debajo de su pie. Él piso en el documento hecho bola
que había descartado.
En ese momento.
1 La primera se refiere a Ladrón por el
trabajo シーフ(Thief), mientras el segundo al
ladrón refiriéndose a criminales 盗賊(bandidos/ladrones)
2 Chainspell – El kanji original es 連続魔. Esto es una habilidad en FFXI.
3 Doramata – ドラまた. El segundo sobre nombre de Lina
Inverse, es llamada “Dragón Hablador” en inglés.

Okaa-san Capitulo 2 (Parte 1)

Capitulo 2: Es solo una coincidencia que sean solo chicas.
No me malinterpreten. No me miren con esa sonrisa.
El tutorial fue terminado. Fue
finalmente momento para comenzar la aventura.
Masato y Mamako se movieron fuera del
palacio de transportación, cruzando el ultimo puente desde la isla flotante, y
llegaron a una isla que era el punto final y también el punto de partida.
Y entonces, los dos que estaban de pie
en el Círculo Mágico trazado en el piso esperaron por ese momento.
“Debería estar bien esperar por la
transportación aquí, ¿correcto?”
“Si, eso es cierto. Esta también escrito
en el libro guía… Ah, pero… parece que tomara algo de tiempo para la
confirmación de seguridad, así que por favor lean los asuntos básicos mientras
esperan. Esta también escrito para hacerlo junto con mi niño. Aquí, mira.” Ella
presiono de cercas.
“Y-ya lo sé. Más bien, estas acercándote
demasiado. Es demasiado ya.”
Empujando el hombro de Mamako que estaba
presionando en él, se deslizo a través de los contenidos del libro guía.
El juego online a donde Masato y los
otros fueron transportados era [MMMMMORPG(temporal)].
Este juego parecía usar el servidor
principal que la Oficina Gabinete estaba a cargo como el punto de inicio, al
conectar con los servidores locales individuales de cada una de las cuarenta y
siente prefecturas a cargo, ellos diseñaron y programaron un mundo
Solo eso, era la versión beta ahora,
ellos estaban en la mitad de recolectar datos desde los jugadores de prueba,
así que solo el servidor de Tokyo fue utilizado.

“Oi oi, esos son varios mackerels[1]
o más bien ya son suficientes… Esto no es a una escala a medias…”
“¿Mackerels? … Saba… saba… Hey Maa-kun,
¿Dónde está escrito este mackerel? Mama no lo encuentra.”
“Ahh, mackerel es, en otras palabras,
“¿Oh es eso así? Así que el servido es
de hecho mackerel… mackerel es asombroso después de todo. Es bueno para tú
salud, e incluso sale en juegos.”
“No, eso no es lo que quiero decir… haa,
bien lo que sea… No habrá final si explico cada cosa pequeña.”
Más que eso, la prioridad era revisar el
fuera de línea. Continuando con afirmar el libro guía.
El servidor de Tokyo que era actualmente
usado había construido este mundo en un tema común de fantasía. El entorno fue
hecho usando el escenario Europeo. Parece haber usado los escenarios de bahías
Mediterráneas que aún había en varios vistazos de Edad Media restantes para
fundar la forma del terreno.
En una nota de lado, parece que el
tiempo fluía en el mundo y el mundo del juego como el mismo. Masato y su madre
fueron transportados en la tarde así que… ah.
“Oh, finalmente huh.”
El Círculo Mágico bajo sus pies
repentinamente libero luz destellante, envolviendo a Masato y su madre. Ellos
desaparecieron junto con la luz.
En el ocaso del atardecer, placentera
brisa marina fluia. Un pueblo con calles labradas con piedras y murallas
blancas se mostraron ante sus ojos.
Viendo eso, las primeras palabras de
Mamako fueron.
“¡Oh mira! ¡Parece como costa!”
“Costas, dices… incluso si le digo a mi
mama sobre cosas como fantasía o paisajes de otro mundo, no podría entenderlo,
no puedo evitar que estés sorprendida… bien entonces, por el momento, vamos a
El primer punto de partida del mundo era
[Reino Kassan].
Moviéndose desde el punto de
teletransporte con un Círculo Mágico trazado, pasando a través de la puerta
robusta, ellos llegaron a la capital del Reino Kassan. La capital se desplegaba
con el castillo real blanco como el centro.
Los edificios hechos de arcilla blanca
de pared y ladrillos daban una sensación de seguridad y un profundo sabor de la
tierra a quien mirara. El sonido viniendo de carruajes de caballos pasando por
traer humor de vuelta. Si alguien viviera en aquellas casas una vez, ellos tal
vez sienten que aventurarse podría ser demasiado problemático. Tal escaparate
“¿¡Ha!? ¡Hay varias tiendas en ese lado
de la calle! ¡Vamos a ir y darle una mirada! *¡Dash!”
“No no, deberíamos ir alrededor del
pueblo una vez para notar la geografía… Uh, ¿¡ella ya corrió!? ¿¡Es esta la
velocidad de mama, no, especialidad de un personaje femenino!?”
Mamako aprendió la habilidad de búsqueda
de compras a alta velocidad 【Alma de Comprador en Ventana】.
No, fue una broma. No había tal
Si tú cambias a una calle diferente, ese
lugar era una encrucijada para calma y reclamos. Al momento que ellos pusieron
un pie dentro, fuertes gritos vinieron de los tenderos promocionando sus
tiendas para atraer clientes.
“¡Espere, jovencita de ahí! De seguro
usted viste algunas ropas extrañas. ¿Es usted una viajera de un mundo
extranjero? Entonces échele una mirada a los productos de mi tienda. ¡Me
asegurare de ser baratos para una linda jovencita como usted!”
“Oh cielos, llamarme jovencita. Aunque
yo ya tengo tal gran hijo.”
“Está bien no decir algo como esto cada
vez. Geez… ah, hola.”
“¿Eh? ¿Es ese tu hijo?… ¿Es usted una
dama con su hijo?”
“Ah, pero ahora somos compañeros madre e
hijo. Haberme vuelto compañera de mi hijo. ¿No es eso encantador?”
“¿Compañeros madre e hijo? … Err…?”
“¡Tu no hables como ser compañeros o lo
que quieras! ¡Eso hará al tendero congelarse! ¡Okay, muévete! ¡Comienza a
Masato cargo el equipaje en sus hombros
para pagar un poco su culpa, y empujo a Mamako, que estaba saludando de vuelta
a cada una de las personas que encontraban, en su espalda.
Los dos se veian como un par de madre e
hijo viajando de paseo en un mercado sobre el mar al aire libre, pero ellos
entendían que no era simplemente un punto de turismo.
“Este lugar es en verdad dentro de un
RPG de fantasía…”
Con solo una mirada, había tiendas
vendiendo espadas y lanzas, tiendas vendiendo escudos y armaduras, y gente que
se ven como guerreros con aquellos equipos caminando derechos pasan frente a
sus ojos. La sensación de aquellas túnicas cortas de chicas que tienen un aire
de magos fluye ligeramente como pasan al lado.
en verdad fantasía… así de increíble… estoy dentro de un juego…
Sintiendo la credibilidad de esto solo
ahora, Masato sin intención se emocionó.
Mamako se acercó para observar a su hijo
y darle, a quien estaba mostrando esa apariencia, una mirada de lado.
“Hey Maa-kun. Deja de sonreír mientras
fisgoneas las caderas de aquellas chicas. Eso te hara ver como un pervertido,
“¡Estas mal! ¡No estoy mirando ese tipo
de cosas!”
“Ufufu. Solo bromeaba. Mama propiamente
entiende lo que Maa-kun está pensando sobre esto justo ahora. Somos mama e hijo
ya vez, podemos leer la mente del otro.”
“¿Hou? Entonces intenta hacer una
“Cierto no, Maa-kun… ¡te sientes feliz
por estar caminando con mama! ¡Heheh!”
Mamako declaro confiadamente con su
sonrisa en completa felicidad.
Masato pudo solo gruñir. Qué es lo que esta persona está diciendo. No
tengo idea.
“Nai waa. Sentirme feliz por estar
caminando con mama es la razón más imposible. Esta madre totalmente no tiene
idea sobre los sentimientos de un adolecente. Ah geez, totalmente fallaste.
Fallaste como una madre.”
“Tú sabes, por las palabras que mama ha
escuchado hasta ahora, aquellas son las segundas más dolorosas. *sob sob*”
“¡Po-por favor para de decir esa línea!
¡Mi elección de palabras fue pobre! ¡Me disculpo!”
Él hizo una disculpa inclinándose a
noventa grados. Manteniendo esa pose de disculpa, él reviso la condición de su
Mamako estaba sonriendo felizmente. Su rostro,
que era incluso juvenil debería tener un límite, mostraba una sonrisa pícara.
“Ufufu, eso es en verdad efectivo.
Entonces mama convertirá aquellas palabras en Magia de Mama.”
“magia que debilita el estado mental del
héroe-hijo… Que maliciosa…”
Parece que Masato, que había justo
recuperado de su impacto de antes, tomo un poco más de tiempo para recuperarse
ahora. Eso de lado.
“Hmm, ¿es así? Vamos a caminar por el
momento, pero deberíamos ir a un lugar después…”
“Ufufu. Déjaselo a mama. Mama propiamente
te guiara después de todo.”
“Guiarme dices… mama no sabes nada sobre
este tipo de juegos, ¿correcto?”
“Eso es verdad, pero está bien. Porque
mama tiene esto.”
Mamako orgullosamente mostro el libro
guía. Ya veo. Está orgullosa que tiene
“No podemos ser negligentes en la
preparación para nuestra aventura. Así que primero de todo…”
“Reunir acompañantes. Supongo.
“Si, eso es correcto. El libro guía
también sugiere reunir compañeros primero. Ese siendo el caso… Muy bien, es
aquí. Este camino.”
La guía de Mamako presento un edificio
que era firmemente construido en la esquina del distrito comercial a él.
A primera vista, parece ser una tienda
de café con una terraza, pero viendo a la gente viniendo y saliendo de tener
cuerpo robusto mientras carga equipos y armaduras protectoras, ellos entienden
bien que este no era un lugar para disfrutar el té. Aventureros en el área de
la terraza disparan miradas de evaluación que no contiene piedad a este lugar,
dándoles a ellos una buena probada de un humor de agresiva bienvenida.
El cartel colgado afuera del edificio
Aventurero』. En otras
palabras, eso significa.
“Este lugar no da una vibra de amateur o
ingenua. Puedo sentirlo… Fuu, justo lo que quería.”
“Oh bien, Maa-kun, que usualmente solo
dice ‘Aaa’ o ‘Lo que sea’. Está diciendo tales palabras geniales… Mama ha
descubierto un nuevo lado de su hijo.”
“¡Ca-cállate! ¡No evalúes los
comentarios de tu hijo!… Tan difícil…”
“Ufufu. Lo siento por eso. Ahora bien,
Maa-kun, ¿puedes pasarle a mama sus espadas?”
“¿Eh? A-aah, muy bien…?”
Él no tenía idea que es lo que ella
estaba pensando. Él solo paso la Espada Sagrada de la Madre Mar Altra que
estaba atascada en la bolsa tipo Boston.
Mamako balanceo su espada hacia el
edificio del gremio. Mamako ataco “… ¿Eh?” Agua desbordo desde el destello de
la espada color azul profundo que fue balanceada “Espe…” y se volvió en gotas
de agua “¿Oii?” que fueron disparadas juntas.
*¡Zugagagagagagagagaagagagaag!* Balas de
agua a alta velocidad atacaron al gremio. Un sonido abrumador de destrucción
hizo eco continuamente, pilares y paredes llenas de agujeros colapsaron. Gritos
de aventureros fueron escuchados solo un momento después de la caída.
Masato, que esta paralizado por eso,
solo regreso a sus sentidos después de eso.
“… Um, mama… qué estás haciendo…?”
“Ser molestados no es bueno, así que tal
vez vaya con [¡Agallas!] Desde el comienzo. El libro guía menciona esto.”
“El significado de agallas es diferente…
o más bien, esto no es mal.”
[Kiel: Hace referencia a las ‘agallas’
que muestra uno cuando enfrenta a la típica escena cliché del matón molesto
cuando te registras o visitas un gremio por primera vez…]
La mitad del frente del edificio del
gremio ha sido medio-destruido. Sin embargo, el problema más grande fue la
seguridad de aquellos aventureros en la terraza. Si alguien se volvió víctima
del ataque de Mamako.
o intento de PK… ¿no recibiremos una penalidad?’
PK—o Player Killer (Asesino de Jugador).
Ellos podrían matar otros personajes. Aquellos que comentan eso podrían darles
el castigo correspondiente. Diciendo lo siento podría no resolver esto.
Masato estaba de pie ahí con rostro pálido
mientras movimientos vinieron desde el lado del edificio. Alguien cruzo los
restos de la puerta destruida y estaba caminando hacia ellos.
La otra parte parece ser una mujer. Ella
está vistiendo un uniforme como Clerk, con largo cabello negro y un rostro
La cabeza de esa persona estaba
ligeramente sangrando.
“O viajeros en un viaje, bienvenidos al
Gremio de Aventureros. Soy la recepcionista Shirarase como informomo. Si estas
en búsqueda de compañeros de su viaje, por favor venir a este lugar.”
Esa persona llamada Shirarase con gesto calmado
y su mano guiándonos mientras su cabeza está aún sangrando.
La persona que estaba sentada en el
escritorio medio-destruido era…
“Umm, Shirase-san…”
“Creo que ya he infoformado[2]
a usted que soy la recepcionista Shirarase, ¿no es así? Si no esta satisfecha,
¿debería tomar aquellas cosas que su hijo no quiere saber de su madre para ver
más? *¿Drip?*”
“¡Esta es mi primera vez conociendo a
Shirarase-san! ¡Gusto en conocerla-ssu! ¡Chii-ssu![3]”
El nombre de la mujer en el escritorio
medio destruido era Shirarase. Ella se veía muy parecida como Shirase, o más
bien, no había duda que ella era la persona en sí, pero ella es Shirarase.
“Entonces, una vez más. Bienvenidos al
Gremio de Aventureros. *Drip.*”
“Gracias y por favor cuide de nosotros.
Así, umm… ¿esta usted bien? Ha estado sangrando desde hace rato.”
“Por favor no se preocupe sobre esto.
Esto es solo un acto… Y esta mi es un objeto, no un PC o NPC. Además no debería
haber penalidad de PK. El objeto edificio siendo posible destruir es un bug, así
que por favor ignórenlo.”
“Y-ya veo. Estoy agradecido~… Qué alivio,
“¿Eh? S-si, eso es cierto”
“Así que esto significa que en la
batalla de objetos, el PC del NEC ganara la batalla PK, ¿algo como eso cierto?”
“Bueno, sí. Por el momento a ser, eso
está bien. Es un asunto asombroso.”
Objetos eran generalmente algo que no
actua como un personaje. PC era personaje jugador, NPC era personaje no
jugador. Él podría dar a Mamako una lección de apoyo en aquellos términos
“Entonces, sin ir más profundo, déjeme
presentar los aventureros registrados en este gremio. Aquí.”
Como Shirase dijo eso, ella tomo fuera
algunos documentos. Fue una pila de papeles tipo parche grueso. Aquellas pilas
de papeles enumerados rondaban los cientos o más.
“E-estos son demasiados…?”
“Este es solo sobre un décimo del total.
Ya que no hay límite para el número de miembros de equipo, por el bien dejar
elegir los acompañantes como gusten y reunirlos, el equipo administrativo
trabajo arduamente para hacer esto. El número está planeado a incrementar en el
“En verdad… erm, entonces, ¿son todos
los compañeros NPC?”
“Los jugadores de prueba son también
incluidos. Sin embargo, hay pocos de ellos, así que me pregunto si puede
considerar esto como una rareza.”
“Este desarrollo es como intentar tu
suerte en gacha, huh…”
[Kiel: Aunque ya lo explique en otra
novela… es los juegos de suerte en coleccionables…]
“El primer piso del edificio está bajo
reparación. Por favor usen el cuarto privado en el segundo piso para investigar.
Traeré más documentos luego, así que por favor tómense su tiempo”
Sobre el primer piso del gremio que
parece como el sitio después de una balacera, ellos se dirigen a un cuarto
privado en la parte de atrás del segundo piso que de alguna forma no fue
Masato tiro los documentos en la mesa
con un sonido fuerte, y se sentó en el lado opuesto, de cara a Mamako.
Para calmar su corazón nervioso, él tomo
unos pocos suspiros profundos de la brisa fresca que fluía desde la ventana, y
comenzó la selección de acompañantes.
“Muy bien, este es mi turno. Déjamelo a
mí, al veterano MMORPG, elegiré los compañeros más adecuados. ¿Esta eso bien,
“Por supuesto. Mama está mirando delante
a lo que mi niño Maa-kun elegirá. Encuentra una buena chica.”
“Po-porque estás diciendo que el
candidato tal vez sea una mujer…”
“¿Pero no se supone que sea así? Ya que
estaremos viviendo juntos desde ahora, es una experiencia con un montón de
cosas juntos, crecer juntos, tu estas mirando por compañeros con eso en mente,
¿cierto? Mama piensa que esto es lo mismo como elegir tu novia o compañera para
“Uu… eso no es exactamente mal, pero…
esto es elegir compañeros. Esto es puramente elegir compañeros. Un.”
Pero ser el tipo de rostro o cuerpo,
aquellos que podrían definitivamente reflejar las preferencias de quien elige.
De todas maneras.
Masato miro a los documentos. En el
documento, el nombre del aventurero y profesión, todos los estados, e incluso
un retrato de la persona actual fue grabada.
“El criterio principal a juzgar es la
formación de batalla, huh… tenemos dos atacantes físicos, así que… primero, un
defensor y un sanador. Un atacante mágico, y también un apoyo podría ser bueno…
ah, pero hay también profesiones de producción… Quiero al menos una persona con
producción de objetos para ser mi compañero también… vamos a tomar siete
miembros como la marca y buscar…”
Con profesión como una guía, rostro y
cuerpo como referencia, incluyendo un poco de la preferencia personal, Masato
comenzó a sacar personal potencial.
“Ooh, este parece bueno.”
Compañero candidato uno. Su nombre era
[Rushiela]. Dieciséis años. Su profesión era Caballero Pesado. Una profesión
especializada en defensa que podría tomar el ataque enemigo con una mano, pero
ella tenía una habilidad que podría convertir una porción del daño tomado en
poder de ataque, así que era posible para ella participar en ataque si lo
Su retrato era también de buen aspecto.
Armadura de metal sobre su delgado cuerpo, un escudo robusto sostenido por sus
delgados dedos, una fuerza escondida dentro de un aspecto digno… Ella dio una
impresión bastante buena, pero su lado lindo tal vez salga después de romper a
través de su dura coraza, un buen talento que podría también espera de un gap
“El siguiente es… ¡ooh, elfo
Compañero candidato dos. Su nombre era
[Sarite]. Diecinueve años(Conversión de edad Humana). Su profesión era
Sacerdotisa. Una experta en magia de recuperación. Capaz de purificar
Túnica verde brillante envuelve su
cuerpo, un pendiente con Árbol Sagrado con cadena ajunta a su mano… Una
elegante onee-san estaba dibujada en su retrato, a pesar de ser un retrato,
mostraba una hermosa elfa con sonrisa gentil.
“Bien, bien, he reunido algunos
candidatos de alta calidad. Luego es… ¡oh, chica sucia encontrada!”
Compañero candidato tres. Su nombre era
[Torino]. Catorce años. Su profesión era Ladrón.
Ella tenía habilidades de apoyo tales
como prevención de golpes y incrementar la velocidad del equipo. Otros incluían
la habilidad de Desbloquear.
Ella vestía un top simple y pantalones
cortos. Su rango de exposición era también fuera excesivo ya que estaba
ligeramente equipada. Sin embargo, si ella se movia mientras estaba siendo
ligeramente equipada, tal vez sea capaz de atrapar la vista de su antebrazo. Él
no sabía hacia donde poder mirar.
“Muy bien, muy bien, echar una mirada es
también bueno. Ese color de piel es también grandemente bienvenida… Así que,
bueno, por ahora debería ir con esto.”
Masato alineo los tres documentos que
tomo, y reviso ellos de nuevo. La defensa, recuperación, u entonces el apoyo al
equipo Él creía que los miembros necesarios para la batalla han sido zanjados.
“Ok, lo he decidió… Mama, tomemos estas
tres personas como nuestros compañeros primero. Por favor confírmalos al
“Oh bueno, son todas lindas chicas. ¿Son
todas las preferencias de Maa-kun?”
“¡Tú no tienes que hacer ese tipo de
confirmación! ¡Solo paso naturalmente de casualidad! ¡Una coincidencia!”
“Ufufu. Entonces mama lo dejara como
Mamako parecía convencida de algo a si
misma y ligeramente choco sus manos.
“Así que ahora, sigue la entrevista de
“… ¿Hah?”
Entrevista de Mama, Mamako parecía haber
dicho eso.
“Una entrevista con Mama. Ya que son las
chicas que tal vez se vuelva la novia de Maa-kun, mama tiene que saludarlas
propiamente a ellas. Mama también quiere saber qué tipo de chicas son ellas.”
“Guh… eso es uhh…”
No era completamente imposible, más
bien, él incluso esperaba por eso un poco, pero no podía decirlo.
“¡Más que eso! ¡Esto no es lo que quería
decir! Es sobre solo eso que pasen la inspección de mama puedan volverse
nuestros compañeros, era tal cosa…”
“Parece ser interesante, así deme
infoformar que adoptaremos el sistema de inspección de madre.”
Shirarase repentinamente apareció en la
habitación, sosteniendo documentos adicionales y un conjunto de señales O y X.
En un apuro, la entrevista de mama fue
1 Mackerel –鯖(さば) tiene la misma
pronunciación como servidor en Japonés. Terminologia gamer usada por jugadores
2 Infoform – En el texto, la original [報せ] Shirase y
[知らせ] shirase
fue el chiste de entonces. Aquí el nombre NPC es [シララセ] Shirarase y el chiste continua con un extra ‘ra’ se volvió [知ららせ] shirarase.

3 Chii-su – Una
manera informal de decir hola en Japón, usado entre subordinados o compadres
hacia su jefe. En una nota aparte, la terminación –ssu es también una forma de
mostrar una relación subordinado-jefe.

Okaa-san Capitulo 1

En este capitulo hay neologismos respectivos a tecnología y videojuegos y datos sobre la misma, cualquiera que no entienda lo siento, pero es un dolor en el **** explicar algo que ya es conocimiento general.

Capitulo 1: Justo cuando la gran aventura del joven está a punto de comenzar… 

Eh, que diablos es esto…
“Todos lo han hecho, ¿correcto? Muy
bien, comiencen a recoger las hojas los de atrás.”
Después de escuchar la instrucción del
maestro de pie frente a nosotros, los estudiantes sentados en la última fila se
levantaron y empezaron a recoger los papeles en su fila.
Ellos nos dieron una encuesta nombrada
‘encuesta de relación padre-hijo’. No estaba impresa en un papel normal, sino
papel de alta calidad hecho en un cuadernillo. Parece justo como las hojas de
preguntas de exámenes de entrada a la universidad, y la información dentro
parece ser solo importante.
Eso fue a esperar. Esto fue conducido
por el Ministro de Asuntos Interiores (de la Rama de Política Civil) por motivo
de entender como los jóvenes actualmente piensan. Era algo a ser ejecutado como
parte de la política nacional.
“Ara, ahora que lo pienso, es en verdad
sorpresivo que nuestra escuela es seleccionada para esta encuesta. ¿Entienden
eso? Todos ustedes han sido seleccionados como representantes de los jóvenes de
esta nación. ¿Qué honorable es eso? Pueden incluso alardear sobre esto a
El maestro se siente profundamente
conmovido compartiendo sus pensamientos.
Pero desde la perspectiva de los
estudiantes que se quedaron después de clases para llenar tal problemática
encuesta, la mayoría de ellos piensa: Qué
demonios, que honor es esto, sáquenme de eso.

Oosuki Masato era uno de ellos.
“Quiero ir de regreso antes para jugar
videojuegos… Tal malgasto de tiempo”
Masato sacudió su cabello en frustración
y suspiro profundamente.
Calma. Está hecho. Eso es todo. Pasa la
encuesta al compañero que las está juntando. Okay, termino.
Dejemos a los tontos ser tontos, y
pensar sobre el juego. ¿Debería poner mi trasero en coleccionar los raros
ingredientes para crear mis equipamientos a 100% de éxito, o usar ingredientes
normales para jugar la ruleta de 75% de éxito?
Pero una cosa esta molestándome.
“¿Qué demonios fue esa pregunta?” Él
murmuro para sí mismo.
Una de las preguntas de la encuesta sacudía
en su mente.
Q: ¿Te volverías cercano con tu madre si
los dos fueran enviados a una aventura, juntos?
Masato en verdad estaba molesto con esta
pregunta en la encuesta que hizo antes. Aunque esta encuesta fue hecha por el
motivo de configurar las políticas nacionales, tal pregunta mentalmente
inexplicable fue preguntada así sin más. ¿Eran ellos serios?
“El que hizo la encuesta tiene un
cerebro mierda… definitivamente un perdedor.”
Fue Japón volviéndose como esto, o era
ya demasiado tarde… Él suspiro en exasperación.
Solo déjalo ser. Ya termino. Apúrate en
ir a casa y jugar mi juego felizmente. Parece que somos libres de irnos, tiempo
para dividir.
En ese momento el maestro que recogió la
encuesta dijo:
“*Suspiro* Como esperaba. El blanco en
la última página de la encuesta no quiere decir que es para sus nombres, pero
es que aún alguien lo lleno con su nombre. Oh bueno, no les diré que no
“Espera, ese debería ser yo… Olvídalo,
solo es mi imaginación… ¡Juego de internet, internet!”
Masato no noto la mirada de su profesor,
y dejo la clase en largas zancadas.
Varios días después, durante el fin de
La escuela estaba fuera después de la
mañana, Masato regreso a casa después de tener su almuerzo y noto un par de
zapatos en la entrada. Eran tacones altos de mujer.
Mama parece tener varios pares de
zapatos como estos. Pero por la manera que están arreglados correctamente en el
centro de la entrada, probablemente pertenecen a una invitada. El sonido de
carcajeadas de la sala de estar confirman este punto.
“Es una amiga de Mama…? ¿Debería
¿Debería ser yo un niño obediente de
valor de elogio? ¿O pasar del problemático asunto de decir hola a la invitada
de Mama?
Sentí un poco el dilema, pero mi cuerpo
que estaba ligado a mi corazón quería apurarse a regresar a mi habitación y
jugar juegos. Decido rendirme como silenciosamente escabullirme pasando por el corredor…
Tch, esto no es bueno.
“¡Aquellas pisadas tal vez sea, Ma-chan!
La puerta de la sala se abrió
repentinamente, revelando el rostro de Oosuki Mamako.
Fue un rostro que traía problemas a
Masato grandemente. Cuando él vio ese rostro incluso su propio hijo Masato se
sentía con duda.
“¿Es esta persona en verdad una madre?
¿Es ella en verdad mi Mama?”
Eso era debido a que Mamako parecía
demasiado joven, su hermoso rostro era solo demasiado juvenil.
Mamako que estaba sonriendo
brillantemente no tenía alguna arruga alrededor de sus ojos, su piel era tersa
y suave. Su cabeza de largo y lustroso cabello lacio que parecían de un ángel.
El padre de Masato no se casó de nuevo,
ella era una normal madre de 40 años de edad con un hijo en el primer año de
preparatoria, pero el rostro juvenil de Mamako era cercano a una adolescente.
“Debería haber un límite de que tan
joven se puede ver… En verdad, que es con mi madre…”
Ella parecía tan joven que era raro.
Gracias a eso, la gente que la conocía por primera vez no podía decir que ella
ya era madre… Para Masato, Mamako sería como está más que problemático.
Eso es correcto, problemático. No
directos sentimientos de disgusto. Era duro para figurar la manera correcta de
interactuar con su madre y poner la correcta distancia a mantener, es por eso
que adopto una ligera actitud rechazante. Es como era.
Pero la cosa problemática era que su
madre no notaba lo que su hijo pensaba.
“Ma-chan, bienvenido a casa.”
Con una dulce y serena sonrisa, Mamako
se acercó y acerco a Masato con la absoluta confianza que Masato podía aceptar
de ella.
“Bien, lo tienes. No vengas más cerca.”
“Ara, lo siento. Oh cierto, ¿Cómo estuvo
la escuela?”
“*Suspiro* promedio… ¿Acaso algo malo
“Lo usual.”
“Así que, estas feliz como siempre…? Oh
cierto, ¿acaso quieres comer? ¿Necesitas que mama haga algo?”
“Lo que sea.”
“Lo que sea… ¿Acaso no me necesitas?
¿Acaso comiste fuera con tus compañeros? ¿Es eso lo que quieres decir?”
“Si… Oh cierto, suficiente sobre mí.
¿Hay un invitado cierto?”
“¡Ah! ¡Si! Es un importante invitado
hoy, ¿puedes venir y decir hola, Ma-chan? Quiero a mi hijo de quien estoy tan
orgullosa también. ¿Okay?”
“Nada… ¿Así que vas a ir a saludarla?”
“Quiero decir que no quiero. Entendido…
En verdad.”
¿Quién podría querer hacer algo tan
problemático? Masato volteo su espalda a Mamako e intento caminar fuera de la
sala brevemente. Pero sus ojos pasaron a conocer con la invitada cuando él vio
inconscientemente hacia la sala.
“Oh, parece que tu hijo finalmente está
en casa.”
La otra parte no parecía como un amigo
que vino a visitar a su madre. Su largo cabello negro y lacio, ropas formales
la hicieron ver como una señorita intelectual. Masato pensé que ella podría ser
una agente seguramente… pero no tenía idea que ella fuera de una extraordinaria
Ella se levantó inmediatamente y camino
hacia Masato con largos pasos como mostraba ella su tarjeta de identificación
en su cuello.
Impreso en la tarjeta era ‘Ministro de Asuntos
Internos (Rama de política civil) policía oficial’. Un impresionante título.

“Gusto en conocerte. Mi nombre es
Shiraishi Masumi. Permítame notificar: estoy visitándole por el motivo de la
encuesta de Ministro de Asuntos Internos. Porque soy Masumi…”
[TL: Su nombre suena como notificar en japonés.
Un chiste… Kiel: *Bam dum tisss]
“Gu-gusto en conocerle… Porque está
haciendo chistes de todo tan repentinamente…?”
“Permítame notificar: porque fui tratada
mal sobre esto en mi niñez, así que en lugar de hacer bromas de eso, debería
ser mejor para mi decir un chiste primero.”
Esta persona parece haber perdido el
camino en su pelea para combatir su complejo de inferioridad.
En ese instante, Mamako sin decir nada
se acercó a Masato… Esta estaba muy segura que su hijo podría aceptarla, pero
esta distancia era demasiado cercas para él.
“E-Erm, Ma-chan, la encuesta que
Masumi-san menciona…”
“Ah, ¿es esa encuesta de relación
“¡Sip, eso es correcto! ¿Cómo fue que sabes?”
“La hice en la escuela el otro día.”
“*Suspiro*… ya veo… Ma-chan, tu nunca lo
“No hay necesidad de reportar tales
cosas triviales. ¡Y estas demasiado cercas!”
Empujo a mi madre que está tratándome
como una mascota.
“Bien entonces, Masumi-san, ¿esa
encuesta debería estar hecha ya, correcto?”
“No aún. Yo solo estoy tomando un
descanso. Hablando de eso, Mamako-san se puso de pie cuando su hijo regreso a
casa… Mamako-san, en verdad adoras a tu hijo.”
“No me gusta mi madre si es lo que piensas.”
“¿¡Ehh!? ¿¡Ma-chan debería gustarle Mama
también cierto!? Para tu madre, Ma-chan es…”
“Detente, eso es molesto. Y cuando fue
que te acercaste de nuevo… Y no me llames por ese nombre tan embarazoso. Ya te
he dicho eso millones de veces, deberías recordarlo ya.”
“Porque si Ma-chan es Ma-chan. Tu madre
siempre te llamo Ma-chan, así que tengo que llamar Ma-chan como Ma-chan. Si
Ma-chan no le gusta el nombre de Ma-chan, pensare en un nuevo nombre para
“Ahh… Suficiente, detente.”
Después de alejarse de su madre que
podía colarse a su lado incluso cuando la alejaba.
“Ya veo, Masumi-san. Ella es mi Mama que
requiere un montón de tiempo para encargarse, así que por favor continúe con su
“Muy bien, continuare entonces… Oh
cierto, tengo algo que pedirles. La encuesta esta vez será incluida una sesión
uno a uno con el padre, y entonces el hijo antes de recolectar los resultados…”
“Si el padre e hijo dicen cómo se
sienten del otro podría desviarse de su objetivo. Así que no quieres un desvió en
ti, ¿correcto?”
“Es eso correcto, pero por favor
permítame la notificación. Soy Masumi que notifica después de todo.”
“Lo siento… ¿Pero qué es lo que piensas,
Era naturaleza humana a querer escuchar
en cuando ellos no querían participar.
Incluso así si era sobre como un padre
se sentía.
“Para ser honesto, lo que mi madre
piense sobre mi… Estoy curioso sobre eso…”
Pero Masumi estaba conduciendo una
encuesta formal en aras del gobierno. Si Masato dijera algo aquí, podría
volverse una información relevante, y tal vez llevar a asuntos grandes. Es
natural para ella por solicitar esto.
“Entendido, entonces iré de regreso a mi
“Gracias por tu cooperación. Soy Masumi iré
a notificar cuando este hecho, por favor relájese en su habitación antes de
eso. Acaso espera por Masumi para notificarte.”
“Lo tengo, bien entonces…”
“¡Ma-chan, espera! Como debería mama
“¡Como demonios debería saber!”
Después de reprochar a Mamako
fieramente, Masato se sacudió la mano de ella y corrió a su habitación en el
segundo piso.
Después que Masato dejo la habitación…
Mamako estaba en lágrimas y limpiando su
rostro con toallitas, terminándose una caja casi al instante. Ella entonces
ventilo sus dificultades en ser una madre de un chico.
“De hecho entiendo a una cierta
extensión. Masato está ya en la preparatoria, y está en una edad cuando él se
siente avergonzado por estar en buenos términos con su madre.”
“Esto es solo natural. En la encuesta
hecha por el Ministro de Asuntos Interiores en el pasado, tal situación fue
común, Masumi está diciendo que esto es normal, porque Masumi…”
“Pero incluso así, aún quiero que mi
relación con mi hijo sea mejor. Después de todo, somos un único par de madre e
hijo en este mundo.”
“Por supuesto una madre podría querer
llevarse bien con su hijo… De hecho, tengo una hija, y puedo entender cómo te
“Ya veo… Masumi-chan tiene una niña
“Si, ella tiene 5 años. Una edad
problemática en todas las maneras.”
“5 años de edad huh… Ya veo… Correr por
sí mismo y decir todo tipos de cosas… Llorando a Mama con ella corriendo para
abrazar tus piernas… Tal edad.”
Como Mamako recuerda como su hijo
actuaba cuando él era pequeño su expresión se vuelve cabizbaja.
“Si es posible, me gustaría regresar a
ese tiempo, aunque eso es solo mis pensamientos… Ma-chan siempre parece
letárgico… Le compre una computadora para felicitarle por entrar a la
preparatoria, pero el comenzó a engancharse a sí mismo en juegos y dejar de
hablarme a mi después de eso…”
“Eso es cierto. Él usualmente dice
‘promedio’, ‘lo que sea’, ‘bien’, cualquier cosa, terminando la conversación
como así… Pero hablando de eso, así es como un típico chico adolescente es,
Mamako-san, como una madre, deberías mantener una apropiada distancia también,
¿no debería eso ser mejor?”
“Pero… Pero no nos llevaremos bien de
esa manera…”
“Ya veo… Hmm… Esto es típico para una
familia con adolescentes… Tal rareza es solo bien… Hmm…”
Masumi considerándolo por un momento y
haciendo su decisión. Ella saca fuera una pila de documentos desde su bolsa.
‘MMMMMORPG (Prueba) Registro de
El documento con este título fue dado a
“Eso es… ¿¡Quieres decir, mi aplicación
fue aceptada!?”
“Eso es correcto. Creo que la situación
de Oosuki-san con su niño completa los requerimientos para participar en este
plan. Así que acepto tu aplicación… Por favor esté preparada tan pronto como
sea posible.”
“¡Mu-muy bien! Las necesidades… ¡Primero deberían ser los zapatos de Ma-chan, no puedo olvidarlos! ¡Oh cierto! ¡Debería
dejar eso por ahora, debería explicar esto a Ma-chan!”
“Déjeme notificar a su niño. Porque soy
Masumi. Notificar es mi llamado.”
“… Eso es lo que pensé, Masumi podría
algunas veces omitir cosas que deberían ser notificadas. Masumi seria popular
incluso si ella actúa un poco infantil algunas veces.”
“Porque estás diciendo cosas raras del
todo tan de repente…”
Con Masato, estaba jugando en la
internet en su habitación, él repentinamente escucho la voz de Masumi. Él
volteo y encontró a Masumi de pie justo ahí.
“Al menos toca…”
“Es molesto interrumpir la mente de
otros a medio camino, es mejor guardar silencio y no tocar.”
Ella estaba hablando sin sentido de
Masumi dijo como ella miraba al monitor.
“Hee, ¿jugando un MMORPG?”
“Hey, no mires…”
“El frame rate para el 3D es en verdad
alto… La computadora de Masato usa una tarjeta gráfica de nivel nuclear huh. El
humor de la liberación de calor es poderosa. Incluso elegiste un mouse de baja
latencia, impresionante.”
“G-gracias por tu cumplido. Pero esto es
de hecho lo que mi Mama compro por sí misma. Alguien le recomendó esto a ella
apasionadamente. ¿Masumi-san, eres familiar con esto?”
“Fui intimidada debido a mi nombre, y
odio ese sentimiento. Así que me quede en casa durante mis días escolares y
aprendí un poco de esto. Solo entiendo el sistema computacional, así que puse
un montón de esfuerzo para entender eso también.”
“Diciéndome cosas que no quiero saber.
Esa es la personalidad de Masumi… Vamos directo al tema principal. ¿Tú quieres
decirme que la encuesta de mi madre está hecha?”
“Si, luego debería ser… notificar que
Masato deberá comenzar una nueva vida desde ahora.”
“… ¿Ah?”
Masato estaba pensando, ‘Esta persona está
hablando sin sentido de nuevo…’ Masumi vio su oportunidad y rápidamente llego
al botón de ‘ESC’ y presionándolo. El juego desapareció del monitor
Y Masumi estaba presionando en la
espalda de Masato.
La parte trasera de la cabeza de Masato
fue acolchonada por pechos, y su teclado fue robado forzosamente. Después de
comenzar un buscador, una URL fue tipeada dentro.
La URL era
“¿¡Qué diablos!? ¿¡Hey, que estás
haciendo!? ¿¡Que sitio es este!?”
“Déjame preguntar una cuestión para
referencia… La encuesta por el Ministro de Asuntos Interiores concluye que
varios jugadores de juegos de internet quieren entrar al Mundo del Juego.
¿Acaso tú te sientes de la misma manera, Masato?”
“B-Bueno, si puedo hacer eso, quiero
darle un intento… ¿¡Pero que es el link!?”
“¿Qué si puedo hacer ese deseo realidad?”
“¿Huh?… Ta-tal cosa es…”
Masato no pudo terminar su sentencia.
Al momento que Masumi golpeo Enter, luz
fluyo fuera del mouse de baja latencia. La luz fluyo fuera como las olas de un
océano y engullo a Masato en un instante y jalo a Masto dentro del mouse.
“Po-podría… ¿¡esto ser!?”
“¡Eso es correcto! ¡Esto es como
comienza! ¡Esto es exactamente lo que estás pensando!”
“¡¡¡En verdad voy a ser transportado
dentro de un mundo de juego!!!”
Masato se rindió a resistir. Él relajo
sus manos agarradas a la mesa y permitió a su cuerpo sumergirse con el flujo.
El mouse que era físicamente imposible
para pasar a través acepto su cuerpo sin alguna resistencia. En este momento.
“… ¡Ma-chan!… ¡Espera!…”
Él pensó escuchar la voz de Mamako.
Masato grito hacia su madre que él no podía ver.
“Madre, lo siento… Regresare pronto.”
No importa qué, él quería disculparse,
su disculpa lleno su corazón enteramente.
Porque su padre fue postulado sobre el
mar por su trabajo, solo los dos estaban viviendo juntos. Si su hijo
desaparece, Mamako estaría sola. Eso no sería bueno, y era natural para él no
querer hacer eso.
Masato no le disgustaba su madre.
Pero si le preguntaba si él quería a su
madre, él definitivamente no podía dar una respuesta concreta.
Y por supuesto, él quería animar a su
única madre en el mundo, y dejarla vivir una vida feliz y plena completamente.
Él nunca vacilo en concentrarse en las expectativas de su madre.
Pero era difícil para él expresar tales
cosas con acciones. Él podría sentirse molesto sobre eso, y no podía tratar con
su madre que parecía tan joven para una madre, y encontró difícil llevarse bien
con Mamako.
Esa fue la manera en que Oosuki Masato
se sentía.
Sin embargo.
“Iré a través de una gran aventura y
volverme más fuerte… Tal vez pueda ser más cercano con mi mama después de
experimentar esto… eso sería genial.”
Él no sabía cuándo iba a regresar. Pero
él definitivamente se sobrepondría a su timidez y diría ‘Estoy en casa’ a su
madre gentilmente con un abrazo.
Con tal pensamiento gentil, Masato paso
a través de un normalmente impasable muro dimensional.
Masato entonces aterrizo.
En un espacio que fue completamente
diferente a su habitación, había un cielo sin fin, y un grupo de islas flotando
arriba y abajo. En el borde de una de las islas estaba un altar de piedra, y
Masato estaba de pie ahí.
Con un brillante círculo mágico bajo sus
Había algunas pequeñas cosas en ambos
lados de los pies de Masato. Era un grupo de lagartos, pero ellos tenían 8
Los lagartos de ocho patas escupieron
pequeñas flamas como si intentaran intimidar a Masato, pero corrieron cuando
vieron la voluntad de pelear de Masato.
Tales creaturas definitivamente no
existían en Japón, donde Masato vivía. Probablemente no existían en la tierra
“Po-¿¡podría esto en verdad ser!?”
No había otra posibilidad.
¿Este era un mundo de juego? ¿Tema
fantasía? ¿En verdad? ¡En verdad!
¡En corto, Masato!
“¡¡¡¡¡¡¡¡¡Lo hice!!!!!!!!”
¡Estoy aquí! ¡Finalmente aquí! ¡La
transportación está hecha! ¡Hola, realidad alterna!
¡¡¡¡¡¡Las cortinas de una nueva historia
estaba a punto de levantarse!!!!!!!
Sin embargo.
“En verdad, Ma-chan. Te dije que
esperaras, Mama está viniendo también. Pero no quisiste esperar del todo, harás
a Mama triste.”
“… ¿¡Eh!?”
Yo volteo debido a esa voz muy familiar,
y veo a una joven chica de pie ahí.
Ella viste un hermoso vestido de una
pieza, sosteniendo una bolsa llena de tantas cosas que no puede ser cerrada,
como una chica a punto de salir de viaje… Espera.
Ella parece como una joven doncella,
pero ella ya estaba demasiado lejos de serlo.
Ella no era ni otra que la madre de
Masato, Mamako.
“… Huh… Po-porque… no deberías estar
aquí… Como es esto posible…”
“Ma-chan. Vamos a ir en todo tipo de
aventuras junto con Mama. Hehe.”
“¿¡Qu-qué demonios ahhhhh!?”
Masato fue transportado dentro de un
juego, pero su madre fue su acompañante.
¿No puede ser? ¿En verdad voy a ir con
mi madre? No no, eso no debería ser…
No puede ser.
“Muy bien, Ma-chan, este camino. Mama te
“¿Ahh? Okay…”
Masato se movió junto a ella lentamente.
Sus manos eran sostenidas como él caminada delante.
Ellos se movieron de una isla flotante a
otra, pasando a través de un puente de piedra que conecta a las dos
plataformas. Su destino fue una excepcionalmente gran isla.
Al final del camino estaba decorado con
estatuas de todo tipo de deidades, era un edificio majestuosamente en forma de
“Hmm. Cálmate, no pares de pensar.
Pensar cuidadosamente y tomar la situación.”
¿Qué estaba pasando? ¿Qué tipo de
situación era esta? El hecho era, ellos habían sido transportados a un mundo de
juego de fantasía, era claro que todo tipo de cosas iban a suceder. Sin embargo…
madre está aquí! Esta es la parte más extraña. Necesito aclarar esta parte
primero. Sip.
“E-Erm, Mama… Porque estás…”
“Henos aquí. El evento inicial debería
ser en este lugar, vamos a trabajar duro juntos.”
Como camino bajo el pasillo en un
pestañeo, él llego a un lugar que parecía un ‘checkpoint de evento’.
En el centro del palacio como interior,
era también el medio de una gran sala redonda, estaba en esta un viejo hombre
sentado en un trono. Eso era esperado.
Él tenía una figura que era la correcta,
vestía ropas extravagantes y una despampanante capa cocida de hilos de oro y
plata. Una corona decorada con gemas estaba adornando su cabeza. Este hombre
anciano con una blanca barba parecía ser el rey…
“¡Finalmente han llegado! Soy el señor
del palacio de teletransporte, el rey.”
El hombre que clamaba tener el titulo de
rey era el rey. No había soldados ni sirvientes a la vista, pero él era el rey.
“¡He estado esperando por usted!
¡Bienvenido a mis dominios!”
“Muchas gracias por su hospitalidad.
Somos honrados por usted al recibirnos… Muy bien, Ma-chan, haz un saludo
apropiado también.”
“Eh, ah… Hola…?”
Imitando a Mamako, Masato también se
arrodillo ante el trono y se inclinó. Él hizo lo que se le dijo.
El rey era todo sonrisas, y dijo
“Vamos a comenzar con la introducción.
Por favor digan su nombre.”
“Yo soy Mamako. Y este es mi hijo,
“Mamako-dono, y ‘Mi hijo Ma-chan’-dono
¿huh? Entonces el registro…”
“No, ¿¡espere un minuto rey!? ¡Mi nombre
es Masato! ¡Masato!”
“Ah. Así que la madre es Mamako, y el
hijo es Masato, ¿eso estará bien? Los registrare así entonces.”
El rey sacudió su mano. Dos ventanas
emergieron en el aire. Las palabras Mamako y Masato aparecieron en la columna
de nombre, y el registro fue completado.
“Hmm… Qué diablos, esto es como un
registro inicial…?”
“Es correcto. Por cierto, no puede ser
cambiado una vez el registro es hecho.”
“Di eso antes ¡ahhhhhh!”
Registrar el nombre real de uno pasa
todo el tiempo. Y había ocasiones en que no era permitido cambiarlo. Masato que
no podía reprimirlo podía solo golpear el suelo en frustración.
Agradecidamente, es solo el suelo.
“Ahhhh…! Bang…! ¡Bang bang bang!”
“¡M-Ma-chan! ¡No golpees el suelo!
¡Causaras problemas a los de debajo de nosotros!”
“Hohoho. No hay nadie más debajo, así
que déjelo… Para completar el registro, déjenme decirles la situación actual.
Por favor estén listos.”
El rey mueve su dedo y una pantalla se
desliza a la vista. Después de deslizarla horizontalmente a través de varias
pantallas, la información básica de Masato y su madre fue mostrada.
El nombre del personaje de Masato fue
‘Masato’. En verdad fue su nombre real. Trabajo era ‘héroe normal’. Estados de
ataque y defensa eran enlistados también, también palabras de estado como ‘capaz
de combatir’ e ‘incapaz de craftear’.
Hay varias cosas en su mente, la única
que quería decir más era…
“Erm, rey… Qué en el mundo es mi
trabajo, ‘héroe normal’…?”
“Normal es solo normal.”
El rey parece recordar algo, entonces
cierra sus ojos con una sonrisa amable.
“Algo increíble cómo salvar el mundo
podría ser imposible… lidiar con relaciones normalmente, y vivir una vida feliz
normalmente… Realizar tal situación es algo que el héroe normal Masato-dono y
madre del héroe normal Mamako-dono deberían poder hacer.”
Después que el rey dijo la meta, él
apunto hacia la distancia.
“¡Entonces ve fuera, héroe!”
Aunque él había dicho eso tan
“Muy bien, vámonos… ¿¡No espera!? ¡No
podemos irnos aún!”
¿Ir a dónde? ¿Hacer qué? Él en verdad no
lo entendía del todo.
“¿Fuu, no es bueno?”
“¡Por supuesto que no! ¿¡No deberías
explicarnos más!? ¡Incluso no entiendo lo que básicamente es esta situación!”
“Fuu, yo brevemente lo explicare
entonces. Escuchen cuidadosamente.”
Después de aclarar su garganta, el rey
“Puesto simplemente, esta es una versión
beta de un juego web. Por usar tecnología que es clasificada, transportamos el
cuerpo del usuario dentro del juego y darle una cuenta de beta cerrada.”
“Woah, eso fue fácil de entender.”
“Para los jugadores de beta cerrada,
ellos son básicamente seleccionados al tener ciertos estrictos criterios…
Aunque alguna gente lamentable que lleno en sus nombres con encuestas anónimas
son también seleccionados. Debido a eso hizo fácil decidir la selección. No
diremos más sobre esto.”
“Haha. Quien podría hacer algo tan
vergonzoso… Hmm…? Podría ser…”
una voz de quien sabe dónde dijo. Pero
fue probablemente mi imaginación. Espero que fuera mi imaginación.
“Como para el juego en sí, como aún está
en fase de pruebas, el nombre no ha sido decidido. El nombre temporal por ahora
“Juego de Rol Masivo de Multijugador en
Línea…? Puedo sentir un escalofrío…”
“Tiene un tema de MMORPG. Tiene un
amplio rango de selección de trabajo, con elecciones entre combatientes y no
combatientes. El duelo de jugadores está permitido, crear objetos y decorar la
casa de uno está también permitido. Jugadores son libres de elegir cualquier
trabajo también.”
“Entonces porque él mío fue ya…”
“Si. Debido a que necesitamos datos para
la prueba, así que no pueden seleccionar trabajos por ahora, y ellos son
asignados por el sistema. Esto no puede ser cambiado también. Lo sentimos por
“Mi libertad fue tomada desde el
comienzo huh… La gente en este mundo…”
Muy irrazonable y sin límites en cómo
sin sentido eran. Este era como el mundo es.
Sin embargo, era ya genial ser elegido
como un jugador de prueba. Y jugar en un modo de inmersión completa. Para ser
honesto, él estaba feliz sobre esto. Masato se empujó a sí mismo y se puso de
“Hah… Puedo comprender esto. Así que
esto es como un juego de internet ¿correcto?”
“Si. Es genial que entiendas tan rápido…
¿Sobre eso, Mamako-dono? ¿Acaso entiende el sistema de este juego?”
“Erm… bueno…”
“¿Hmm? Si hay algo que le moleste, no
vacile y pregunte. Le responderé paso a paso.”
El rey mostró una sonrisa amable, y
Mamako que estaba en problemas por algo pregunto.
“Bueno, erm… ¿qué es una cuenta?”
““¿Eh, no entendiste desde esa parte?””
El rey y Masato dijeron la misma cosa.
“Hmm… ¿Para referencia, qué es lo que
cree que una cuenta es, Mamako-dono?”
“Cuenta… Hmm…”
Mamako cayo en pensamiento profundo como
ella murmuraba “Ah, ermm ugh” con ella contando sus dedos y preguntando si eso
era así. Ella mostró una sonrisa que parece decir que ella quería preguntar
Sip. Esa fue la extensión de lo que
Mamako sabía sobre juegos de internet.
Con una sonrisa cálida, el rey volteo
hacia Masato.
“Masato-dono, dejare a Mamako-dono a su
cuidado. Buena suerte.”
“¿¡Hey!? ¿¡No me la tires a mí!? ¿¡Haz
algo sobre eso!?”
“¡No puedo hacer nada!”
“¿¡Te haces el tonto conmigo incluso si
tienes que arrojar fuera tu orgullo!?”
“¡Si en verdad quieres saberlo, es
porque soy un NPC! ¡No puedo decir nada si los detalles no están preinstalados!
¡Si quieren que tome el rol de tutor para principiantes, entonces dame un
encriptado limitado a 10kB! ¡Pide a los operadores del lado de trabajo a esto!”
“Eres solo un encriptado compilado, y
aun necesitas hacer solicitud al lado de operadores… Pero son el NPC…!?”
“Por cierto, los jugadores beta y NPC
existen en este juego, y no es posible diferenciarlos a ellos por su
apariencia. Si en verdad quieres saberlo, solo di algo sucio a ellos. NPC
pueden solo responder basados en su configuración dada.”
“¡Quien podría querer usar tal método
Pero podría ser capaz de decir cosas
como esa… Qué es lo que estoy pensando, no quiero hacer tales cosas del todo.
Muy bien.
“Vamos a detenernos aquí por ahora… En
lugar de decir eso, sería más fácil intentar salir en primer lugar…!?”
De todos modos, podría estar bien
después escuchar la explicación. Luego de aceptar esto, Masato repentinamente
recordó algo.
Mal, espera. ¿Esta esto en verdad bien?
Hay aún un problema.
Al lado de Masato estaba Mamako que se
deslizo a su lado cuando ella vio una abertura.
“¡Hey, espera un minuto! ¡No has
mencionado la parte más importante!”
“Bien entonces, qué es lo que también
deseas saber, Masato-dono… ¿Por qué tu madre está acompañándote? ¿Es eso lo que
quieres saber?”
“¡Eso es correcto! ¡Por favor explica
los detalles!”
“Pero no puedo decir nada sobre eso.”
“¿¡Hah!? ¿¡Porque!? ¿Acaso no lo han
“No es eso… Tu madre acompañándote está
profundamente relacionado al objetivo de este juego, así que no puedo divulgar
los detalles. Si lo hiciera, hay una oportunidad que la intención del lado de
operadores podría ser forzado en ti…Eso no es bueno. Por favor intenta
descubrirlo durante tus aventuras, encontrándolo por ti mismo es el resultado
esperamos ver lo mejor.”
“Hah…? Erm… ¿De que estas hablando?”
“El punto de la situación ha sido
conversado con la madre de antemano, está bien para el niño no saberlo. Solo ve
en la dirección que gustes y sería genial si puedes entenderlo después de
aventurarse juntos… Ahora bien.”
El rey se levantó y toco el trono. El
trono desapareció, y el piso de piedra debajo se sumió con un sonido bajo. Una
escalera en espiral apareció justo debajo de esto.
“El siguiente capítulo está comenzando.”
“¡Hey espera! ¡No solo te vayas como esto!
Expliquen propiamente…”
“No digas más y ve. Incluso para un
héroe que está insatisfecho y desconfiado de la situación, esta también
esperando un regalo sorpresa por ti ahí.”
“¡Es inútil engañarme con placeres!”
“¿Oh? ¿Así que no quieres el registro de
nueva cuenta + primer registro en regalo?”
“Eh… Primer registro en regalo…?”
La tentación jalo su corazón
No importa que tipo de juegos de
internet fuera, rendirse en el extravagante registro por primera vez en regalo…
No es algo que una persona normal podría hacer. No importa que tan fuerte luche
uno, ellos no serían capaces de ignorarlo. Forzosamente podría ser más que un
Y por supuesto, incluso un héroe no
puede sobre pasar tales tentaciones…
Bajo la escalera espiral estaba otro
espacio cliché con incontables puertas alineadas junto a la pared. Todas ellas
estaban labradas con trabajos como ‘Paladín’, ‘Hechicero’, ‘Dueño de tienda de
flores’ o ‘Granjero’.
Una de esas era la habitación de
‘héroe’. Al momento Masato siguió al rey dentro, la insatisfacción y
desconfianza en su corazón fue olvidada. Masato trago saliva.
Espadas. Las mejores espadas en el mundo
estaban ahí.
“Oh… Es esto real…”
Dentro la habitación se construía de
rocas planas brillantes, ahí estaba un borde tan largo para alguien a poner sus
brazos alrededor. Tres espadas estaban estancadas dentro.
Una espada color de lava volcánica. Una
espada tan azul como el profundo océano. Una espada transparente que estaba
Incluso Masato que nunca había visto una
espada real antes podía decir que estas tres no eran solo espadas normales. No
era la presión intimidante de un arma, sino algo más… Algo que no podía ser
explicado, ante él estaba la forma física de una existencia de temor y poder.
“Tú sientes algo huh, como esperaba de
un héroe.”
“Estas sobre estimándome.”
“¿Ahora bien, elige una que te guste,
Masato-dono? Está bien darle un intento. Te daré una de las espadas a ti.”
“Que generoso, ¿esta eso en verdad
“Por supuesto… Para ser honesto, esto
fue preparado como la recompensa después de completar la quest más difícil.
Pero recientemente, no podemos atraer la atención de los jugadores si el regalo
en el primer registro no es lo suficiente bueno. Así que no tuvimos elección
sino usar esto para entusiasmarlos.”
“No quería escuchar eso.”
“La gente en estos días tiene salud.
Antes en mis tiempos, todos los héroes se les dejaba ir con un palito.”
“Famicom son gente que debería solo
“Y así, que espada podría ser,
Masato tomo un paso al frente, y camino
sin vacilación hacia la espada transparente.
El porqué, Masato no tenía una respuesta
clara en sí. Es solo el sentimiento de agallas.
“Como podría poner esto… La única que es
adecuada para mi definitivamente es esta… No hay equivocación…”
El sol, luna y estrellas. El delicado
diseño en la empuñadura le recordó el cielo. Masato agarro la empuñadura y
tomo fuera la espada.
La espada parecía como si estuviera
enterrada en una increíble parte dura, pero Masato la jalo sin sentir mucha
“Ya veo. Así que Masato-dono es él héroe
elegido por los cielos sin fin.”
“Elegido por los cielos…?”
“La espada en tu mano es la espada del vasto
cielo abierto, Filament (フィルマメントFirmamento), En
la época del pasado cuando el cielo en este mundo fue desgarrado en la
oscuridad esta es la espada legendaria que desvaneció toda la oscuridad con
solo un tajo… Eso es la configuración.”
“La última parte es innecesaria. Pero
parece en verdad poderosa… En verdad no sé qué tan poderosa es después de tu
explicación a pesar.”
“Permítame explicarlo en una manera
fácil de entender.”
El rey se puso sus anteojos y saco fuera
un libro. El título en la cubierta decía ‘Guia Oficial’, y el rey comenzó a
pasar entre páginas con movimientos practicantes.
“Hmm, blah… provoca doble daño a
unidades aéreas. Tres veces de oportunidad para dar un golpe crítico. El más
alto nivel de ataque de todos los objetos de evento. No intercambiable.”
“Esa es una manera fácil de entender,
pero se siente inútil. Por favor presenta la configuración del mundo
“No te preocupes, lo haremos
definitivamente apropiadamente cuando sea formalmente.”
Como esta era una versión beta, es
imposible para todo ser hecho perfectamente. Masato quería entenderlo más…
Pero ya que no podía buscar respuestas, Masato guardo silencio.
De todos modos.
“Que hay sobre esto, Masato-dono. ¿Aún
no te sientes motivado?”
“Hmm… Bueno…”
El rey estaba en lo correcto.
Revelaciones huh. Al momento que sostuvo la espada sagrada de los cielos
Filament, Masato sintió algo cambiar en su corazón.
“Estoy sosteniendo una espada justo
La sensación en su mano le estaba
diciendo algo. Eso era el instinto grabado en todo hombre—la necesidad de un
hombre para dar batalla estaba siendo sacada.
Y Masato estaba sosteniendo una espada
sagrada. La arma de mas alto grado. La existencia más fuerte para aventureros y
¿No había alguna razón para rechazar tal
gloria? Él no podía encontrar alguna.
“Hah… Estoy totalmente convencido,
aunque me siento extraño.”
“Puedo empatizar contigo, pero
resuélvelo por ti mismo. Solo piensa de esto como el destino del héroe
“Ya veo… Ah, incluso si me llaman un
héroe, no puedo entenderlo inmediatamente.”
“¿Qué estás diciendo? Masato-dono esta
ya sosteniendo la espada legendaria ¿correcto? Eso es algo que no podría ser
usada a menos seas un héroe. Esta más que dudar que Masato-dono es un héroe. No
hay equivocación en esto, eres un héroe pienses lo que pienses.”
“Ah, incluso si tú dices eso… se siente
“No hay nada por lo que avergonzarse
¿correcto? Masato-dono es un héroe. El Valiente de este mundo. ¡Tal vez incluso
el salvador de este universo!”
“Co-como dije… No lo pongas de esa
manera… estas sobre estimándome.”
Valiente. Héroe. Salvador. El valiente
que era un héroe salvador. El triple combo aterrizo, ¿¡fue eso una broma!?
“Francamente hablando… cuando el juego
pueda ser oficialmente liberado podría depender de los resultados del juego de
prueba. Confiamos pesadamente en tu presentación… Por favor guía este mundo
dentro de una nueva era. Eres el único que puede lograr esto.”
“Eh…? Bueno, si soy el único que puede
hacerlo, supongo que lo hare por esto.”
“Hoho, ese es el espíritu. Ma-chan
definitivamente puede hacerlo. Porque eres el hijo de que esta madre esta tan
“Hmm… ¿el hijo que te hace orgullosa?
Por supuesto… hey…”
“Entonces Mama tomara prestadas las
espadas.” Con un pesado sonido metálico rasgo fuera las dos.
Mamako saco la espada color antorcha y
la espada azul profundo.
¿No eran aquellas espadas legendarias
solo para el elegido que podrían empuñarlas? Ella tomo ambas tan fácilmente.
El rey que sintió que las cosas
progresaban calmadamente y el molesto Masato desviaron sus ojos. ¿Eh, espera?
¿Qué acaba de pasar? ¿Puede alguien explicarme?
“E-Erm… rey, qué es…?”
“Lo siento. No puedo decir nada más. Por
favor perdona a este NPC… ¿Sobre esto? Debo entregarte esta libro guía a Mamako-dono.
Por favor úselo como guste.”
Después de entregar a Masato el regalo
complementario para Mamako, el rey se desvaneció.
Después se abrió la puerta en la
parte más profunda de la puerta del héroe, una arena redonda apareció. No había
nadie en los asientos de audiencia, solo un solitario escenario en el espacio
sin fin. Este lugar fue hecho para peleas de tutorial.
Masato de pie en el borde del escenario
busco a través del libro de guía. Encontrando la información que quería
“Terra di Malote (テラディマドレ) y Altra (アルトゥーラ)”
El nombre de las espadas en manos de
Terra di Malote era la espada color
flama. La espada sagrada de la madre tierra. Fue nacida cuando el mundo fue
creado. La espada que era la fuente de toda vida en este mundo, es era lo que
la introducción decía.
La espada azul profundo era Altra. La
espada sagrada de la madre océano. Fue dicho que un tajo podría suprimir el
flujo que asalta el mundo. La introducción también comenta que era el sello de
contrato que separada la tierra del mar.
Vamos ahora para solo saber que tan
poderosas son las espadas.
“Terra di Malote: causa doble de daño a
monstruos terrestres, ataca a todos los objetivos. Tres veces la oportunidad de
causar un golpe crítico. El más alto nivel de ataque de todos los objetos de
evento. No intercambiable.”
“Altra: causa doble daño a monstruos
marinos, ataca a todos los objetivos. Tres veces la oportunidad de causar un
golpe crítico. El más alto nivel de ataque de todos los objetos de evento. No
Nota especial de estado que el ‘daño
promedio’ era aplicada cuando atacaba a todos los objetivos. El daño en un
ataque podría ser predeterminado y dividido igualmente de acuerdo al número de
Esto era como el arma era cuando era usada.
“¡Mira cuidadosamente, Ma-chan! Mama
está haciéndolo ahora… ¡Hei!”
Mamako elevo Terra di Malote en su mano
derecha arriba y trazo hacia abajo.
En el mismo momento, incontables
estalagmitas filosas como espadas salieron disparadas desde el suelo, y
cortaron a los monstruos.
Las hormigas, gusanos, arañas, lobos,
osos y todo tipo de monstruos se desvanecieron después de dividirse en dos.
Todo parecía ser fácil.
Sin embargo, un nuevo mob de monstruos
apareció inmediatamente.
“¡Mama no perderá! ¡Le mostrare a
Ma-chan mi mejor lado! … ¡Hei!”
Mamako sostuvo Altra en su mano
izquierda y la balanceo horizontalmente.
Después de eso, un torrente de agua
salió del espacio cortado por la espada y se partió en incontables flujos, que
eran entonces disparados como balas.
El agua disparada a ultra rápida
velocidad, y los monstruos mostrados fueron agujereados, colapsando el cuerpo
en un instante. La segunda ola de enemigos fue exterminada también. Muy fácil.
Pero no había terminado aún. La batalla
estaba aún activa. ¡Figuras enemigas aparecieron en el cielo!
“¡Ma-chan! ¡Ahora es el momento para
mostrar tu poder! ¡Trabaja duro!”
“… Ah, muy bien…”
Ma-chan cerró el libro guía y empuño
Filament en la dirección apropiada.
En esa instancia una onda de choque
salio de la espada transparente, y persiguió al enemigo automáticamente. La
energía de la espada se movió libremente y golpeo el enemigo.
Uno de los monstruos voladores que era
del tamaño de un perico fue golpeado y se convirtió en cenizas.
¡El monstruo fue asesinado!
Y Masato cayo de rodillas al suelo sus
lágrimas caían libremente.
“… Ugh… Mal… Algo está mal… Esto es definitivamente
“¿¡Qué ocurre Ma-chan!? ¿¡Estas herido!?
¿¡Deja a Mama echar una mirada!?”
“No… no estoy herido… No es eso…”
Filament era fuerte. Podría liberar un
ataque, una espada excepcionalmente fuerte. Él podría estar confiado e incluso
orgulloso sobre esto.
Pero el ataque normal de Mamako golpea a
todos los objetivos, y con dos espadas, ella podía atacar doble.
Comparado a su madre que derroto docenas
de monstruos fácilmente…
“Soy… en verdad débil…”
Él podría solo llorar. Arrojaba pataleos
por pretender dormir. ¿Qué podría hacer con esto?
Mamako se acercó a Masato que se puso
como esto.
“¡Ma-chan! ¡Anímate! ¡el ataque de
Ma-chan es poderoso! ¡No solo es transparente, incluso fluyo fuera con un boom,
Mama esta impactada! ¡Ma-chan mira también!”
“Por favor, no me hables de esa manera…
Ya estoy así de deprimido, ¿puedes no solo añadir sal a las heridas?”
“¡N-no quería decir eso! Eso no es…
¡Okay, de todos modos, levántate! Vamos a comenzar el Tuto… espera… qué es esa
“… Tutorial.”
“¡Eso es! Mama hizo eso en el pasado
también. Llendo ‘Fuwah fuwah’ con sus amigos.”
“Mal. Está completamente mal. Nunca he
jugado un juego de alineación en un punto y girar alrededor.”
“Y-ya veo. Es verdad que ahora no es el
momento para recordar el pasado… Bueno… ¡De todos modos, eso es por ahora,
vamos a movernos! ¡Cierto, vamos a hacer eso! ¡Yo definitivamente seré
Como ella dijo eso, Mamako puso su mano
hacia Masato para ayudarlo a levantarse.
Masato golpeo su mano alejándola.
“Si quieres ir de aventura, Mama puede
solo ir sola. Hay tal vez monstruos fuera de aquí, pero Mama tiene más que
suficiente poder de fuego. Puedes tener victorias perfectas desde el comienzo.”
“¿Poder de fuego? Mama no puede escupir
fuego a pesar. No soy una estufa de gas.”
“No quiero decir ese tipo de poder de
Poder de fuego era otra manera de decir
capacidad ofensiva. Una frase que tomaron por el poder de fuego de las armas de
fuego. Tal vez sea un poco difícil para entender para las madres. Pero dejando
eso de lado ahora…
“Hah… Muy bien, solo ve. Déjame solo
“Pero porque…”
Masato se rindió. Él se rindió en todo.
Él se tiro al suelo plano en una manera exhausta, como si quisiera rendirse en
respirar también. Como si estuviera muerto. Actuando como un cadáver sin alguna
“Hmm… Masato… Qué debería hacer durante
un momento como este… ¡Ah, eso es correcto!”
Mamako que estaba en problemas levanto
el libro guía que Masato tiro casualmente al lado. Ella se deslizo a través
francamente como si ella estaba tomando ramas.
“Donde es esa guía estratégica… Qué
hacer si el héroe hijo le disgusta aventurarse juntos…”
“¿Cómo es posible que tal escenario
especifico este incluido? Qué diablos es ese libro guía…?”
“Cuando él sepa que tu ataque normal es
un doble golpe a todos los objetivos, tú hijo debería estar muy feliz. Él
definitivamente abrazara tus piernas y te implorara ir de aventura con él. ¡Eso
es lo que dice, pero eso no tiene sentido! ¡Ma-chan no es feliz del todo!”
“… Bueno, esto es algo para ser feliz a
“¿Eh, es eso así?”
“Por supuesto. ¿Un alto poder de fuego
con ataque a todos los objetivos? Y doble golpe…? Si conociera tal jugador,
haría todo lo que pudiera para invitarlo. Y formar un equipo incluso si tengo
que pagarle.”
“Entonces porque no eres feliz…?
Mamako cayó en un profundo pensamiento y
dejo salir “Ohh”, como si encontrara la razón.
“Podría ser… Si no estoy mal, es porqué…
¿Soy tu madre?”
“Eso es correcto, esa es la raíz del
problema… ¿Es este un buen momento?”
Masato se levantó y dio a la cara a
Manteniéndose genial y recordándose a si
mismo a no perder su temperamento, él digo seriamente.
“Por favor explícalo.”
“Explicar qué…?”
“Todo. Todo esto. Tú deberías ser capaz
de explicar la situación entera a mi ahora… Mama, tú definitivamente sabes algo
¿cierto? El rey dijo que tu eres el asunto principal. Tú conversaste con el
personal de operación del juego antes ¿correcto?”
“Para ser honesto, transportarme dentro
del juego es ya extraño, pero dar la bienvenida así no prueba nada… Sin
embargo, esto es diferente de como imagine transportarme dentro de un juego
podría ser. De porqué es diferente, eso es que estás aquí también, Mama.”
“Las mamas de otras familias a veces
son transportadas dentro de un juego con su hijo también.”
“¡No hay manera! ¡Absolutamente no!
¡Imposible! ¡O más bien, debería ser en verdad problemático estar así! ¡No
quiero una historia de fantasía girando hacia chicos en pubertad teniendo un
padre alrededor! ¡Eso es molesto!”
“Ugh, Ma-chan, la manera en que lo pones
es en verdad dolorosa. Mama esta platinum enojada.”
[Kiel: Referencia a Araragi de
Monogatari Series.]
Mamako inflo sus mejillas como si ella
intentara un berrinche. Mamako se enojó. Que linda persona…
espera! ¡Esa es mi madre! ¡Mi madre que es de cerca de 40 años! ¡El término
linda no debería ser considerado del todo! ¡No hay manera!
“¡Deja de bromar conmigo! ¡No hagas esa
cara y responde propiamente!”
“¡M-Muy bien! ¡Te responderé!”
“Porque mi Mama vino junto conmigo, como
las cosas se tornaron como esto, por favor explica en detalle. Vamos.”
“P-pero… Sería mejor no decir nada justo
en el comienzo… Ir de aventuras juntos y experimentar todo tipo de cosas
juntos, y sería lo mejor si lo descubres por ti mismo…”
“¡Suficiente, solo escúpelo! No lo hagas
tan frustrante…! Ya tengo suficiente de esta madre mía…”
“Qué es lo que pasa…?”
“Quiero romper nuestras relación como
madre e hijo.”

Él dijo en el calor del momento. Esas
palabras sin pensar se escupieron en frustración.
Él lo hizo muy agitado. Pero su
agitación sin control fluyo sin pensarlo… y golpeo a Mamako directamente, y
robo su expresión en un instante.
“… Ah… No… Justo ahora…” Cuando Masato
noto que la había cagado, era ya demasiado tarde.
Lagrimas seguían saliendo de los ojos de
Mamako que había perdido su sonrisa, cayendo con pequeñas perlas.
Su madre lloro como ella miraba en
frente de él en tristeza.
“… Yo lo siento. Yo como tu madre, como
podría poner yo esto, en verdad no lo sé. Shirase-san y los otros parecen tener
sus razones también, ¿así que como debería decirte? En verdad no lo sé.”

“Si si. Lo tengo. Ya que hay alguna
razón, eso está bien…”
“Pero vamos a hacer esto claro. Madre
nunca haría nada para herir o mentir a Ma-chan. Por favor cree esto.”
“Si, ya entendí.”
“Solo quería llevarme mejor con Ma-chan.
Ir de aventura con Ma-chan, charlar juntos, trabajar duro juntos y volvernos
una madre e hijo íntimos. Eso es todo lo que quiero. Es por eso… sob… es por
“¡Entiendo, lo tengo! ¡Ya lo entendí en
verdad! ¡Completamente!”
“Es por eso qué, por favor…”
“Si si…”
“No digas algo tan hiriente, como romper
nuestra relación como madre e hijo… Desde el día en que te di a luz, estas son las
palabras más dolorosas e hirientes para mí.”
Lágrimas de dolor fluían de los ojos de
Mamako sin alguna resistencia y mostraron signos de no parar.
Masato se maldijo…
Él hizo a su familia llorar de tristeza.
Esta situación la hizo el mismo, y de frente a él estaba su amada (madre)
que estaba con el corazón roto y perdido.
Ella sufrió tal horrible dolor debido a
su hijo.
“… Qué es lo que hice ahora..”
Esta no era una plática irracional. Como
el hijo nacido de su madre, cuando le fue entregada la vida, él ya sabía el
deseo de amor para vivir enérgicamente con una sonrisa por siempre. Si el la
hizo triste, su alma podría sentirse mal. No había manera que pudiera resistir
o ignorar esto completamente.
“¡Lo siento mama! ¡Eso fue mi culpa! ¡No
quería decir eso del todo! ¡Aunque lo que dije no es lo que dije! Es por eso…!”
favor perdóname. Por favor no llores. Si me disculpo con todo mi corazón…
El sentía su cabeza oprimida. Mamako
gentilmente acaricio su cabello como ella dijo ‘este chico’.
“… ¿M-mama?”
“A mama en verdad le gusta el gentil
Ma-chan que se preocupa sobre cómo me siento.”
“G-gracias… En verdad lo siento por
decir algo extraño.”
“Si, está bien… Esto es suficiente.
Aquí, levantame.”
“Ah, ah… Entonces…”
Después de levantarse, él vio el rostro
lagrimoso de su madre de nuevo. Él no podía mirarla directamente, así que
Masato volteo su mirada atrás de él. En ese momento, Mamako dijo: “Eh, deberías
mirar al rostro de la otra persona cuando están hablando ¿entendido?”
“Lo tengo.”
Mamako tomo una pose, haciendo una
muestra de esperando ser la compañera de Masato.
“Ah… nunca imagine que vería a mi madre
posando como esto.”
“*Suspiro* Mira cuidadosamente. Y
escucha a tu Mama propiamente.”
“Si si…”
“Mama quiere ir de aventura con
Ma-chan. ¿Puede mama ser la compañera de Ma-chan?”
¿Dejar a su madre ser una acompañante?
Él no vacilo del todo. Había solo una
“… Bueno, eso esta bien. Mama tiene
poderoso poder de fuego, y definitivamente será de ayuda. En lugar de preguntar
ser una compañera… O más bien… sería genial si puedes venir.”
“Muy bien. Esta concluido entonces. Por
favor cuida de mi desde ahora, Ma-chan.”
“Si, bien… Yo también, por favor cuida
de mi Mama.”
Mamako se volvió un acompañante.
“Pero Ma-chan, tengo algo que decir.”
“¿Hmm? ¿Qué?”
“Mama no puede escupir fuego ¿entendido?
No soy una estufa de gas.”
“¡Como he dicho no es ese tipo de poder
de fuego! ¿¡Cuantas veces tengo que decirte eso Mama!?”

El más grande enemigo en esta aventura es probablemente la habilidad de compresión de mama… Masato predijo.

¿Acaso a tu madre le gustan… Prologo

Prologo: La respuesta de un cierto joven

Pregunta: Es tu relación con tu madre,
Pregunta: ¿Acaso hablas con tu madre?
¿Cuánto te comunicas con ella?
Pregunta: ¿Hay algo que te haya hecho
feliz con tu madre recientemente?
Nada en específico.
Pregunta: ¿Hay algo que te haya hecho
infeliz con tu madre recientemente?
Es un dolor cuando ella me llama por mi
nombre de bebe.
Pregunta: ¿Sales con tu madre por cosas
como compras?
Pregunta: ¿Ayudas a tu madre con los
Depende de mí humor.
Pregunta: ¿Conoces lo que a tu madre le
Cosas del hogar y cazar descuentos.
Pregunta: ¿Conoces lo que a tu madre le
Cucarachas en la cocina.
Pregunta: ¿Qué piensas que es lo bueno
sobre tu madre?
Ninguna cosa.
Pregunta: ¿Qué piensas que es lo malo
sobre tu madre?
Lo que sea.
Pregunta: ¿Te volverías cercano con tu
madre si los dos fueran enviados a una aventura, juntos?

¿Probablemente no nos volveríamos cercanos? No demasiado seguro.

‣・( ^ω^)・・・ Próximamente (El jueves) el capitulo 1… Esperenlo…