Okaa-san Capitulo 2 (Parte 1)

Capitulo 2: Es solo una coincidencia que sean solo chicas.
No me malinterpreten. No me miren con esa sonrisa.
El tutorial fue terminado. Fue
finalmente momento para comenzar la aventura.
Masato y Mamako se movieron fuera del
palacio de transportación, cruzando el ultimo puente desde la isla flotante, y
llegaron a una isla que era el punto final y también el punto de partida.
Y entonces, los dos que estaban de pie
en el Círculo Mágico trazado en el piso esperaron por ese momento.
“Debería estar bien esperar por la
transportación aquí, ¿correcto?”
“Si, eso es cierto. Esta también escrito
en el libro guía… Ah, pero… parece que tomara algo de tiempo para la
confirmación de seguridad, así que por favor lean los asuntos básicos mientras
esperan. Esta también escrito para hacerlo junto con mi niño. Aquí, mira.” Ella
presiono de cercas.
“Y-ya lo sé. Más bien, estas acercándote
demasiado. Es demasiado ya.”
Empujando el hombro de Mamako que estaba
presionando en él, se deslizo a través de los contenidos del libro guía.
El juego online a donde Masato y los
otros fueron transportados era [MMMMMORPG(temporal)].
Este juego parecía usar el servidor
principal que la Oficina Gabinete estaba a cargo como el punto de inicio, al
conectar con los servidores locales individuales de cada una de las cuarenta y
siente prefecturas a cargo, ellos diseñaron y programaron un mundo
Solo eso, era la versión beta ahora,
ellos estaban en la mitad de recolectar datos desde los jugadores de prueba,
así que solo el servidor de Tokyo fue utilizado.

“Oi oi, esos son varios mackerels[1]
o más bien ya son suficientes… Esto no es a una escala a medias…”
“¿Mackerels? … Saba… saba… Hey Maa-kun,
¿Dónde está escrito este mackerel? Mama no lo encuentra.”
“Ahh, mackerel es, en otras palabras,
“¿Oh es eso así? Así que el servido es
de hecho mackerel… mackerel es asombroso después de todo. Es bueno para tú
salud, e incluso sale en juegos.”
“No, eso no es lo que quiero decir… haa,
bien lo que sea… No habrá final si explico cada cosa pequeña.”
Más que eso, la prioridad era revisar el
fuera de línea. Continuando con afirmar el libro guía.
El servidor de Tokyo que era actualmente
usado había construido este mundo en un tema común de fantasía. El entorno fue
hecho usando el escenario Europeo. Parece haber usado los escenarios de bahías
Mediterráneas que aún había en varios vistazos de Edad Media restantes para
fundar la forma del terreno.
En una nota de lado, parece que el
tiempo fluía en el mundo y el mundo del juego como el mismo. Masato y su madre
fueron transportados en la tarde así que… ah.
“Oh, finalmente huh.”
El Círculo Mágico bajo sus pies
repentinamente libero luz destellante, envolviendo a Masato y su madre. Ellos
desaparecieron junto con la luz.
En el ocaso del atardecer, placentera
brisa marina fluia. Un pueblo con calles labradas con piedras y murallas
blancas se mostraron ante sus ojos.
Viendo eso, las primeras palabras de
Mamako fueron.
“¡Oh mira! ¡Parece como costa!”
“Costas, dices… incluso si le digo a mi
mama sobre cosas como fantasía o paisajes de otro mundo, no podría entenderlo,
no puedo evitar que estés sorprendida… bien entonces, por el momento, vamos a
El primer punto de partida del mundo era
[Reino Kassan].
Moviéndose desde el punto de
teletransporte con un Círculo Mágico trazado, pasando a través de la puerta
robusta, ellos llegaron a la capital del Reino Kassan. La capital se desplegaba
con el castillo real blanco como el centro.
Los edificios hechos de arcilla blanca
de pared y ladrillos daban una sensación de seguridad y un profundo sabor de la
tierra a quien mirara. El sonido viniendo de carruajes de caballos pasando por
traer humor de vuelta. Si alguien viviera en aquellas casas una vez, ellos tal
vez sienten que aventurarse podría ser demasiado problemático. Tal escaparate
“¿¡Ha!? ¡Hay varias tiendas en ese lado
de la calle! ¡Vamos a ir y darle una mirada! *¡Dash!”
“No no, deberíamos ir alrededor del
pueblo una vez para notar la geografía… Uh, ¿¡ella ya corrió!? ¿¡Es esta la
velocidad de mama, no, especialidad de un personaje femenino!?”
Mamako aprendió la habilidad de búsqueda
de compras a alta velocidad 【Alma de Comprador en Ventana】.
No, fue una broma. No había tal
Si tú cambias a una calle diferente, ese
lugar era una encrucijada para calma y reclamos. Al momento que ellos pusieron
un pie dentro, fuertes gritos vinieron de los tenderos promocionando sus
tiendas para atraer clientes.
“¡Espere, jovencita de ahí! De seguro
usted viste algunas ropas extrañas. ¿Es usted una viajera de un mundo
extranjero? Entonces échele una mirada a los productos de mi tienda. ¡Me
asegurare de ser baratos para una linda jovencita como usted!”
“Oh cielos, llamarme jovencita. Aunque
yo ya tengo tal gran hijo.”
“Está bien no decir algo como esto cada
vez. Geez… ah, hola.”
“¿Eh? ¿Es ese tu hijo?… ¿Es usted una
dama con su hijo?”
“Ah, pero ahora somos compañeros madre e
hijo. Haberme vuelto compañera de mi hijo. ¿No es eso encantador?”
“¿Compañeros madre e hijo? … Err…?”
“¡Tu no hables como ser compañeros o lo
que quieras! ¡Eso hará al tendero congelarse! ¡Okay, muévete! ¡Comienza a
Masato cargo el equipaje en sus hombros
para pagar un poco su culpa, y empujo a Mamako, que estaba saludando de vuelta
a cada una de las personas que encontraban, en su espalda.
Los dos se veian como un par de madre e
hijo viajando de paseo en un mercado sobre el mar al aire libre, pero ellos
entendían que no era simplemente un punto de turismo.
“Este lugar es en verdad dentro de un
RPG de fantasía…”
Con solo una mirada, había tiendas
vendiendo espadas y lanzas, tiendas vendiendo escudos y armaduras, y gente que
se ven como guerreros con aquellos equipos caminando derechos pasan frente a
sus ojos. La sensación de aquellas túnicas cortas de chicas que tienen un aire
de magos fluye ligeramente como pasan al lado.
en verdad fantasía… así de increíble… estoy dentro de un juego…
Sintiendo la credibilidad de esto solo
ahora, Masato sin intención se emocionó.
Mamako se acercó para observar a su hijo
y darle, a quien estaba mostrando esa apariencia, una mirada de lado.
“Hey Maa-kun. Deja de sonreír mientras
fisgoneas las caderas de aquellas chicas. Eso te hara ver como un pervertido,
“¡Estas mal! ¡No estoy mirando ese tipo
de cosas!”
“Ufufu. Solo bromeaba. Mama propiamente
entiende lo que Maa-kun está pensando sobre esto justo ahora. Somos mama e hijo
ya vez, podemos leer la mente del otro.”
“¿Hou? Entonces intenta hacer una
“Cierto no, Maa-kun… ¡te sientes feliz
por estar caminando con mama! ¡Heheh!”
Mamako declaro confiadamente con su
sonrisa en completa felicidad.
Masato pudo solo gruñir. Qué es lo que esta persona está diciendo. No
tengo idea.
“Nai waa. Sentirme feliz por estar
caminando con mama es la razón más imposible. Esta madre totalmente no tiene
idea sobre los sentimientos de un adolecente. Ah geez, totalmente fallaste.
Fallaste como una madre.”
“Tú sabes, por las palabras que mama ha
escuchado hasta ahora, aquellas son las segundas más dolorosas. *sob sob*”
“¡Po-por favor para de decir esa línea!
¡Mi elección de palabras fue pobre! ¡Me disculpo!”
Él hizo una disculpa inclinándose a
noventa grados. Manteniendo esa pose de disculpa, él reviso la condición de su
Mamako estaba sonriendo felizmente. Su rostro,
que era incluso juvenil debería tener un límite, mostraba una sonrisa pícara.
“Ufufu, eso es en verdad efectivo.
Entonces mama convertirá aquellas palabras en Magia de Mama.”
“magia que debilita el estado mental del
héroe-hijo… Que maliciosa…”
Parece que Masato, que había justo
recuperado de su impacto de antes, tomo un poco más de tiempo para recuperarse
ahora. Eso de lado.
“Hmm, ¿es así? Vamos a caminar por el
momento, pero deberíamos ir a un lugar después…”
“Ufufu. Déjaselo a mama. Mama propiamente
te guiara después de todo.”
“Guiarme dices… mama no sabes nada sobre
este tipo de juegos, ¿correcto?”
“Eso es verdad, pero está bien. Porque
mama tiene esto.”
Mamako orgullosamente mostro el libro
guía. Ya veo. Está orgullosa que tiene
“No podemos ser negligentes en la
preparación para nuestra aventura. Así que primero de todo…”
“Reunir acompañantes. Supongo.
“Si, eso es correcto. El libro guía
también sugiere reunir compañeros primero. Ese siendo el caso… Muy bien, es
aquí. Este camino.”
La guía de Mamako presento un edificio
que era firmemente construido en la esquina del distrito comercial a él.
A primera vista, parece ser una tienda
de café con una terraza, pero viendo a la gente viniendo y saliendo de tener
cuerpo robusto mientras carga equipos y armaduras protectoras, ellos entienden
bien que este no era un lugar para disfrutar el té. Aventureros en el área de
la terraza disparan miradas de evaluación que no contiene piedad a este lugar,
dándoles a ellos una buena probada de un humor de agresiva bienvenida.
El cartel colgado afuera del edificio
Aventurero』. En otras
palabras, eso significa.
“Este lugar no da una vibra de amateur o
ingenua. Puedo sentirlo… Fuu, justo lo que quería.”
“Oh bien, Maa-kun, que usualmente solo
dice ‘Aaa’ o ‘Lo que sea’. Está diciendo tales palabras geniales… Mama ha
descubierto un nuevo lado de su hijo.”
“¡Ca-cállate! ¡No evalúes los
comentarios de tu hijo!… Tan difícil…”
“Ufufu. Lo siento por eso. Ahora bien,
Maa-kun, ¿puedes pasarle a mama sus espadas?”
“¿Eh? A-aah, muy bien…?”
Él no tenía idea que es lo que ella
estaba pensando. Él solo paso la Espada Sagrada de la Madre Mar Altra que
estaba atascada en la bolsa tipo Boston.
Mamako balanceo su espada hacia el
edificio del gremio. Mamako ataco “… ¿Eh?” Agua desbordo desde el destello de
la espada color azul profundo que fue balanceada “Espe…” y se volvió en gotas
de agua “¿Oii?” que fueron disparadas juntas.
*¡Zugagagagagagagagaagagagaag!* Balas de
agua a alta velocidad atacaron al gremio. Un sonido abrumador de destrucción
hizo eco continuamente, pilares y paredes llenas de agujeros colapsaron. Gritos
de aventureros fueron escuchados solo un momento después de la caída.
Masato, que esta paralizado por eso,
solo regreso a sus sentidos después de eso.
“… Um, mama… qué estás haciendo…?”
“Ser molestados no es bueno, así que tal
vez vaya con [¡Agallas!] Desde el comienzo. El libro guía menciona esto.”
“El significado de agallas es diferente…
o más bien, esto no es mal.”
[Kiel: Hace referencia a las ‘agallas’
que muestra uno cuando enfrenta a la típica escena cliché del matón molesto
cuando te registras o visitas un gremio por primera vez…]
La mitad del frente del edificio del
gremio ha sido medio-destruido. Sin embargo, el problema más grande fue la
seguridad de aquellos aventureros en la terraza. Si alguien se volvió víctima
del ataque de Mamako.
o intento de PK… ¿no recibiremos una penalidad?’
PK—o Player Killer (Asesino de Jugador).
Ellos podrían matar otros personajes. Aquellos que comentan eso podrían darles
el castigo correspondiente. Diciendo lo siento podría no resolver esto.
Masato estaba de pie ahí con rostro pálido
mientras movimientos vinieron desde el lado del edificio. Alguien cruzo los
restos de la puerta destruida y estaba caminando hacia ellos.
La otra parte parece ser una mujer. Ella
está vistiendo un uniforme como Clerk, con largo cabello negro y un rostro
La cabeza de esa persona estaba
ligeramente sangrando.
“O viajeros en un viaje, bienvenidos al
Gremio de Aventureros. Soy la recepcionista Shirarase como informomo. Si estas
en búsqueda de compañeros de su viaje, por favor venir a este lugar.”
Esa persona llamada Shirarase con gesto calmado
y su mano guiándonos mientras su cabeza está aún sangrando.
La persona que estaba sentada en el
escritorio medio-destruido era…
“Umm, Shirase-san…”
“Creo que ya he infoformado[2]
a usted que soy la recepcionista Shirarase, ¿no es así? Si no esta satisfecha,
¿debería tomar aquellas cosas que su hijo no quiere saber de su madre para ver
más? *¿Drip?*”
“¡Esta es mi primera vez conociendo a
Shirarase-san! ¡Gusto en conocerla-ssu! ¡Chii-ssu![3]”
El nombre de la mujer en el escritorio
medio destruido era Shirarase. Ella se veía muy parecida como Shirase, o más
bien, no había duda que ella era la persona en sí, pero ella es Shirarase.
“Entonces, una vez más. Bienvenidos al
Gremio de Aventureros. *Drip.*”
“Gracias y por favor cuide de nosotros.
Así, umm… ¿esta usted bien? Ha estado sangrando desde hace rato.”
“Por favor no se preocupe sobre esto.
Esto es solo un acto… Y esta mi es un objeto, no un PC o NPC. Además no debería
haber penalidad de PK. El objeto edificio siendo posible destruir es un bug, así
que por favor ignórenlo.”
“Y-ya veo. Estoy agradecido~… Qué alivio,
“¿Eh? S-si, eso es cierto”
“Así que esto significa que en la
batalla de objetos, el PC del NEC ganara la batalla PK, ¿algo como eso cierto?”
“Bueno, sí. Por el momento a ser, eso
está bien. Es un asunto asombroso.”
Objetos eran generalmente algo que no
actua como un personaje. PC era personaje jugador, NPC era personaje no
jugador. Él podría dar a Mamako una lección de apoyo en aquellos términos
“Entonces, sin ir más profundo, déjeme
presentar los aventureros registrados en este gremio. Aquí.”
Como Shirase dijo eso, ella tomo fuera
algunos documentos. Fue una pila de papeles tipo parche grueso. Aquellas pilas
de papeles enumerados rondaban los cientos o más.
“E-estos son demasiados…?”
“Este es solo sobre un décimo del total.
Ya que no hay límite para el número de miembros de equipo, por el bien dejar
elegir los acompañantes como gusten y reunirlos, el equipo administrativo
trabajo arduamente para hacer esto. El número está planeado a incrementar en el
“En verdad… erm, entonces, ¿son todos
los compañeros NPC?”
“Los jugadores de prueba son también
incluidos. Sin embargo, hay pocos de ellos, así que me pregunto si puede
considerar esto como una rareza.”
“Este desarrollo es como intentar tu
suerte en gacha, huh…”
[Kiel: Aunque ya lo explique en otra
novela… es los juegos de suerte en coleccionables…]
“El primer piso del edificio está bajo
reparación. Por favor usen el cuarto privado en el segundo piso para investigar.
Traeré más documentos luego, así que por favor tómense su tiempo”
Sobre el primer piso del gremio que
parece como el sitio después de una balacera, ellos se dirigen a un cuarto
privado en la parte de atrás del segundo piso que de alguna forma no fue
Masato tiro los documentos en la mesa
con un sonido fuerte, y se sentó en el lado opuesto, de cara a Mamako.
Para calmar su corazón nervioso, él tomo
unos pocos suspiros profundos de la brisa fresca que fluía desde la ventana, y
comenzó la selección de acompañantes.
“Muy bien, este es mi turno. Déjamelo a
mí, al veterano MMORPG, elegiré los compañeros más adecuados. ¿Esta eso bien,
“Por supuesto. Mama está mirando delante
a lo que mi niño Maa-kun elegirá. Encuentra una buena chica.”
“Po-porque estás diciendo que el
candidato tal vez sea una mujer…”
“¿Pero no se supone que sea así? Ya que
estaremos viviendo juntos desde ahora, es una experiencia con un montón de
cosas juntos, crecer juntos, tu estas mirando por compañeros con eso en mente,
¿cierto? Mama piensa que esto es lo mismo como elegir tu novia o compañera para
“Uu… eso no es exactamente mal, pero…
esto es elegir compañeros. Esto es puramente elegir compañeros. Un.”
Pero ser el tipo de rostro o cuerpo,
aquellos que podrían definitivamente reflejar las preferencias de quien elige.
De todas maneras.
Masato miro a los documentos. En el
documento, el nombre del aventurero y profesión, todos los estados, e incluso
un retrato de la persona actual fue grabada.
“El criterio principal a juzgar es la
formación de batalla, huh… tenemos dos atacantes físicos, así que… primero, un
defensor y un sanador. Un atacante mágico, y también un apoyo podría ser bueno…
ah, pero hay también profesiones de producción… Quiero al menos una persona con
producción de objetos para ser mi compañero también… vamos a tomar siete
miembros como la marca y buscar…”
Con profesión como una guía, rostro y
cuerpo como referencia, incluyendo un poco de la preferencia personal, Masato
comenzó a sacar personal potencial.
“Ooh, este parece bueno.”
Compañero candidato uno. Su nombre era
[Rushiela]. Dieciséis años. Su profesión era Caballero Pesado. Una profesión
especializada en defensa que podría tomar el ataque enemigo con una mano, pero
ella tenía una habilidad que podría convertir una porción del daño tomado en
poder de ataque, así que era posible para ella participar en ataque si lo
Su retrato era también de buen aspecto.
Armadura de metal sobre su delgado cuerpo, un escudo robusto sostenido por sus
delgados dedos, una fuerza escondida dentro de un aspecto digno… Ella dio una
impresión bastante buena, pero su lado lindo tal vez salga después de romper a
través de su dura coraza, un buen talento que podría también espera de un gap
“El siguiente es… ¡ooh, elfo
Compañero candidato dos. Su nombre era
[Sarite]. Diecinueve años(Conversión de edad Humana). Su profesión era
Sacerdotisa. Una experta en magia de recuperación. Capaz de purificar
Túnica verde brillante envuelve su
cuerpo, un pendiente con Árbol Sagrado con cadena ajunta a su mano… Una
elegante onee-san estaba dibujada en su retrato, a pesar de ser un retrato,
mostraba una hermosa elfa con sonrisa gentil.
“Bien, bien, he reunido algunos
candidatos de alta calidad. Luego es… ¡oh, chica sucia encontrada!”
Compañero candidato tres. Su nombre era
[Torino]. Catorce años. Su profesión era Ladrón.
Ella tenía habilidades de apoyo tales
como prevención de golpes y incrementar la velocidad del equipo. Otros incluían
la habilidad de Desbloquear.
Ella vestía un top simple y pantalones
cortos. Su rango de exposición era también fuera excesivo ya que estaba
ligeramente equipada. Sin embargo, si ella se movia mientras estaba siendo
ligeramente equipada, tal vez sea capaz de atrapar la vista de su antebrazo. Él
no sabía hacia donde poder mirar.
“Muy bien, muy bien, echar una mirada es
también bueno. Ese color de piel es también grandemente bienvenida… Así que,
bueno, por ahora debería ir con esto.”
Masato alineo los tres documentos que
tomo, y reviso ellos de nuevo. La defensa, recuperación, u entonces el apoyo al
equipo Él creía que los miembros necesarios para la batalla han sido zanjados.
“Ok, lo he decidió… Mama, tomemos estas
tres personas como nuestros compañeros primero. Por favor confírmalos al
“Oh bueno, son todas lindas chicas. ¿Son
todas las preferencias de Maa-kun?”
“¡Tú no tienes que hacer ese tipo de
confirmación! ¡Solo paso naturalmente de casualidad! ¡Una coincidencia!”
“Ufufu. Entonces mama lo dejara como
Mamako parecía convencida de algo a si
misma y ligeramente choco sus manos.
“Así que ahora, sigue la entrevista de
“… ¿Hah?”
Entrevista de Mama, Mamako parecía haber
dicho eso.
“Una entrevista con Mama. Ya que son las
chicas que tal vez se vuelva la novia de Maa-kun, mama tiene que saludarlas
propiamente a ellas. Mama también quiere saber qué tipo de chicas son ellas.”
“Guh… eso es uhh…”
No era completamente imposible, más
bien, él incluso esperaba por eso un poco, pero no podía decirlo.
“¡Más que eso! ¡Esto no es lo que quería
decir! Es sobre solo eso que pasen la inspección de mama puedan volverse
nuestros compañeros, era tal cosa…”
“Parece ser interesante, así deme
infoformar que adoptaremos el sistema de inspección de madre.”
Shirarase repentinamente apareció en la
habitación, sosteniendo documentos adicionales y un conjunto de señales O y X.
En un apuro, la entrevista de mama fue
1 Mackerel –鯖(さば) tiene la misma
pronunciación como servidor en Japonés. Terminologia gamer usada por jugadores
2 Infoform – En el texto, la original [報せ] Shirase y
[知らせ] shirase
fue el chiste de entonces. Aquí el nombre NPC es [シララセ] Shirarase y el chiste continua con un extra ‘ra’ se volvió [知ららせ] shirarase.

3 Chii-su – Una
manera informal de decir hola en Japón, usado entre subordinados o compadres
hacia su jefe. En una nota aparte, la terminación –ssu es también una forma de
mostrar una relación subordinado-jefe.

Deja un comentario

Este sitio usa Akismet para reducir el spam. Aprende cómo se procesan los datos de tus comentarios.